Incidental Mutation 'R2060:Ltbp4'
ID 228584
Institutional Source Beutler Lab
Gene Symbol Ltbp4
Ensembl Gene ENSMUSG00000040488
Gene Name latent transforming growth factor beta binding protein 4
Synonyms 2310046A13Rik
MMRRC Submission 040065-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2060 (G1)
Quality Score 171
Status Not validated
Chromosome 7
Chromosomal Location 27004561-27037117 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 27008378 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 1310 (R1310Q)
Ref Sequence ENSEMBL: ENSMUSP00000113674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038618] [ENSMUST00000108369] [ENSMUST00000118583] [ENSMUST00000118961] [ENSMUST00000121175] [ENSMUST00000125455]
AlphaFold Q8K4G1
Predicted Effect probably damaging
Transcript: ENSMUST00000038618
AA Change: R1376Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037536
Gene: ENSMUSG00000040488
AA Change: R1376Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 112 125 N/A INTRINSIC
EGF 151 180 2.74e-3 SMART
low complexity region 244 265 N/A INTRINSIC
EGF_CA 356 396 3.51e-10 SMART
Pfam:TB 416 457 4.8e-15 PFAM
low complexity region 490 501 N/A INTRINSIC
low complexity region 507 568 N/A INTRINSIC
low complexity region 579 590 N/A INTRINSIC
EGF 591 629 6.06e-5 SMART
EGF_CA 630 671 8.3e-12 SMART
EGF_CA 672 713 7.34e-13 SMART
EGF_CA 714 751 8.43e-13 SMART
EGF_CA 753 794 1.66e-11 SMART
EGF_CA 795 836 3.61e-12 SMART
EGF_CA 837 876 5.61e-9 SMART
EGF_CA 877 919 1.73e-9 SMART
EGF_CA 920 961 7.12e-11 SMART
EGF_CA 962 1002 3.56e-11 SMART
EGF_CA 1003 1046 1.61e-9 SMART
EGF_CA 1047 1090 2.13e-9 SMART
EGF_CA 1091 1132 1.02e-11 SMART
EGF 1136 1175 1.69e1 SMART
low complexity region 1185 1223 N/A INTRINSIC
Pfam:TB 1234 1276 1.7e-13 PFAM
EGF_CA 1295 1337 2.72e-7 SMART
EGF_CA 1338 1379 1.36e-7 SMART
Pfam:TB 1402 1443 4.3e-14 PFAM
low complexity region 1449 1461 N/A INTRINSIC
low complexity region 1478 1500 N/A INTRINSIC
EGF 1578 1615 6.06e-5 SMART
EGF_CA 1616 1660 9.54e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108369
AA Change: R1375Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104006
Gene: ENSMUSG00000040488
AA Change: R1375Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 116 145 N/A INTRINSIC
EGF 150 179 2.74e-3 SMART
low complexity region 243 264 N/A INTRINSIC
EGF_CA 355 395 3.51e-10 SMART
Pfam:TB 414 456 2.5e-14 PFAM
low complexity region 489 500 N/A INTRINSIC
low complexity region 506 567 N/A INTRINSIC
low complexity region 578 589 N/A INTRINSIC
EGF 590 628 6.06e-5 SMART
EGF_CA 629 670 8.3e-12 SMART
EGF_CA 671 712 7.34e-13 SMART
EGF_CA 713 750 8.43e-13 SMART
EGF_CA 752 793 1.66e-11 SMART
EGF_CA 794 835 3.61e-12 SMART
EGF_CA 836 875 5.61e-9 SMART
EGF_CA 876 918 1.73e-9 SMART
EGF_CA 919 960 7.12e-11 SMART
EGF_CA 961 1001 3.56e-11 SMART
EGF_CA 1002 1045 1.61e-9 SMART
EGF_CA 1046 1089 2.13e-9 SMART
EGF_CA 1090 1131 1.02e-11 SMART
EGF 1135 1174 1.69e1 SMART
low complexity region 1184 1222 N/A INTRINSIC
Pfam:TB 1232 1275 2.4e-13 PFAM
EGF_CA 1294 1336 2.72e-7 SMART
EGF_CA 1337 1378 1.36e-7 SMART
Pfam:TB 1400 1442 7.6e-15 PFAM
low complexity region 1448 1460 N/A INTRINSIC
low complexity region 1477 1499 N/A INTRINSIC
EGF 1577 1614 6.06e-5 SMART
EGF_CA 1615 1659 9.54e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118583
AA Change: R1310Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113523
Gene: ENSMUSG00000040488
AA Change: R1310Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
EGF 85 114 2.74e-3 SMART
low complexity region 178 199 N/A INTRINSIC
EGF_CA 290 330 3.51e-10 SMART
Pfam:TB 349 391 2.3e-14 PFAM
low complexity region 424 435 N/A INTRINSIC
low complexity region 441 502 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
EGF 525 563 6.06e-5 SMART
EGF_CA 564 605 8.3e-12 SMART
EGF_CA 606 647 7.34e-13 SMART
EGF_CA 648 685 8.43e-13 SMART
EGF_CA 687 728 1.66e-11 SMART
EGF_CA 729 770 3.61e-12 SMART
EGF_CA 771 810 5.61e-9 SMART
EGF_CA 811 853 1.73e-9 SMART
EGF_CA 854 895 7.12e-11 SMART
EGF_CA 896 936 3.56e-11 SMART
EGF_CA 937 980 1.61e-9 SMART
EGF_CA 981 1024 2.13e-9 SMART
EGF_CA 1025 1066 1.02e-11 SMART
EGF 1070 1109 1.69e1 SMART
low complexity region 1119 1157 N/A INTRINSIC
Pfam:TB 1167 1210 2.2e-13 PFAM
EGF_CA 1229 1271 2.72e-7 SMART
EGF_CA 1272 1313 1.36e-7 SMART
Pfam:TB 1335 1377 7.1e-15 PFAM
low complexity region 1383 1395 N/A INTRINSIC
low complexity region 1412 1434 N/A INTRINSIC
EGF 1512 1549 6.06e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118961
SMART Domains Protein: ENSMUSP00000113746
Gene: ENSMUSG00000040488

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
EGF 85 114 2.74e-3 SMART
low complexity region 178 199 N/A INTRINSIC
EGF_CA 290 330 3.51e-10 SMART
Pfam:TB 349 391 1.6e-14 PFAM
low complexity region 424 435 N/A INTRINSIC
low complexity region 441 502 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
EGF 525 563 6.06e-5 SMART
EGF_CA 564 605 8.3e-12 SMART
EGF_CA 606 647 7.34e-13 SMART
EGF_CA 648 685 8.43e-13 SMART
EGF_CA 687 728 1.66e-11 SMART
EGF_CA 729 770 3.61e-12 SMART
EGF_CA 771 810 5.61e-9 SMART
EGF_CA 811 853 1.73e-9 SMART
EGF_CA 854 895 7.12e-11 SMART
EGF_CA 896 936 3.56e-11 SMART
EGF_CA 937 980 1.61e-9 SMART
EGF_CA 981 1024 2.13e-9 SMART
EGF_CA 1025 1066 1.02e-11 SMART
EGF 1070 1109 1.69e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121175
AA Change: R1310Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113674
Gene: ENSMUSG00000040488
AA Change: R1310Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
EGF 85 114 2.74e-3 SMART
low complexity region 178 199 N/A INTRINSIC
EGF_CA 290 330 3.51e-10 SMART
Pfam:TB 349 391 3.4e-14 PFAM
low complexity region 424 435 N/A INTRINSIC
low complexity region 441 502 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
EGF 525 563 6.06e-5 SMART
EGF_CA 564 605 8.3e-12 SMART
EGF_CA 606 647 7.34e-13 SMART
EGF_CA 648 685 8.43e-13 SMART
EGF_CA 687 728 1.66e-11 SMART
EGF_CA 729 770 3.61e-12 SMART
EGF_CA 771 810 5.61e-9 SMART
EGF_CA 811 853 1.73e-9 SMART
EGF_CA 854 895 7.12e-11 SMART
EGF_CA 896 936 3.56e-11 SMART
EGF_CA 937 980 1.61e-9 SMART
EGF_CA 981 1024 2.13e-9 SMART
EGF_CA 1025 1066 1.02e-11 SMART
EGF 1070 1109 1.69e1 SMART
low complexity region 1119 1157 N/A INTRINSIC
Pfam:TB 1167 1210 3.3e-13 PFAM
EGF_CA 1229 1271 2.72e-7 SMART
EGF_CA 1272 1313 1.36e-7 SMART
Pfam:TB 1335 1377 1e-14 PFAM
low complexity region 1383 1395 N/A INTRINSIC
low complexity region 1412 1434 N/A INTRINSIC
EGF 1512 1549 6.06e-5 SMART
EGF_CA 1550 1594 9.54e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125455
SMART Domains Protein: ENSMUSP00000120326
Gene: ENSMUSG00000040488

DomainStartEndE-ValueType
Pfam:TB 9 52 1.9e-14 PFAM
Pfam:TB 85 127 6e-16 PFAM
low complexity region 133 145 N/A INTRINSIC
low complexity region 162 184 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206413
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds transforming growth factor beta (TGFB) as it is secreted and targeted to the extracellular matrix. TGFB is biologically latent after secretion and insertion into the extracellular matrix, and sheds TGFB and other proteins upon activation. Defects in this gene may be a cause of cutis laxa and severe pulmonary, gastrointestinal, and urinary abnormalities. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous disruption of this locus results in pulmonary emphysema, cardiomyopathy, and colon cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 119,826,741 (GRCm39) W462* probably null Het
Aftph A T 11: 20,642,571 (GRCm39) Y821N probably damaging Het
Ahnak A T 19: 8,985,405 (GRCm39) M2230L probably benign Het
Arfgap1 T C 2: 180,614,575 (GRCm39) F144L probably benign Het
Arid4b C T 13: 14,370,037 (GRCm39) R1178C probably damaging Het
Asb8 A T 15: 98,039,254 (GRCm39) C49S possibly damaging Het
Baz1b A G 5: 135,233,968 (GRCm39) N165S probably damaging Het
Bod1l A T 5: 41,966,085 (GRCm39) I2660N possibly damaging Het
C2cd3 T C 7: 100,104,155 (GRCm39) I825T probably damaging Het
C4b A G 17: 34,955,075 (GRCm39) W804R probably damaging Het
Cadm3 A T 1: 173,171,969 (GRCm39) D201E probably damaging Het
Cdh17 T C 4: 11,803,982 (GRCm39) F552L probably benign Het
Cdh20 G C 1: 109,976,607 (GRCm39) A91P probably damaging Het
Cela1 A G 15: 100,573,203 (GRCm39) probably null Het
Clk3 T C 9: 57,658,400 (GRCm39) Y582C probably damaging Het
Cma1 C T 14: 56,181,155 (GRCm39) probably null Het
Ctcfl A G 2: 172,960,299 (GRCm39) S95P probably benign Het
Cylc1 C A X: 110,166,892 (GRCm39) T391K unknown Het
Cyp3a11 T A 5: 145,791,891 (GRCm39) I501L probably benign Het
Cyp3a59 T A 5: 146,041,524 (GRCm39) L356Q probably damaging Het
Dcdc2a A C 13: 25,291,693 (GRCm39) D226A possibly damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dlec1 A C 9: 118,941,154 (GRCm39) T235P probably damaging Het
Dnaaf1 G A 8: 120,317,341 (GRCm39) R290Q probably benign Het
Dnaaf5 C T 5: 139,163,758 (GRCm39) R377W probably damaging Het
Dpep1 T A 8: 123,927,130 (GRCm39) V293E probably damaging Het
Drosha T A 15: 12,924,245 (GRCm39) V1209E possibly damaging Het
Dync2h1 T G 9: 7,162,802 (GRCm39) I596L possibly damaging Het
Edem1 T A 6: 108,831,248 (GRCm39) Y570N probably damaging Het
Edrf1 G T 7: 133,258,858 (GRCm39) E9* probably null Het
Enpep T A 3: 129,074,172 (GRCm39) N792Y probably benign Het
Enpp2 A T 15: 54,739,110 (GRCm39) M391K probably damaging Het
Fanca A C 8: 124,001,220 (GRCm39) V1105G probably damaging Het
Fbxo22 T A 9: 55,125,667 (GRCm39) L74I probably damaging Het
Fchsd2 T A 7: 100,926,624 (GRCm39) F571L probably benign Het
Fhad1 T C 4: 141,626,560 (GRCm39) D1345G probably benign Het
G2e3 T C 12: 51,419,389 (GRCm39) F702L probably damaging Het
Glce A T 9: 61,968,228 (GRCm39) S308T possibly damaging Het
Glt1d1 A G 5: 127,734,183 (GRCm39) D119G probably benign Het
Gpr137c T C 14: 45,481,616 (GRCm39) I144T probably damaging Het
Gprin3 A G 6: 59,331,504 (GRCm39) C268R possibly damaging Het
Hadha G A 5: 30,333,834 (GRCm39) T395M probably benign Het
Hdhd2 T G 18: 77,052,738 (GRCm39) probably null Het
Homer2 C T 7: 81,268,451 (GRCm39) E70K probably benign Het
Hp1bp3 T A 4: 137,967,983 (GRCm39) D397E probably damaging Het
Hrh3 T C 2: 179,743,043 (GRCm39) N195S possibly damaging Het
Hyou1 T C 9: 44,292,849 (GRCm39) V153A probably benign Het
Igf2r A T 17: 12,920,206 (GRCm39) S1378T possibly damaging Het
Ints4 G A 7: 97,150,970 (GRCm39) R279H possibly damaging Het
Itga10 A T 3: 96,562,314 (GRCm39) R699* probably null Het
Itpkb A G 1: 180,249,423 (GRCm39) T933A probably benign Het
Itsn2 T G 12: 4,677,879 (GRCm39) F79V probably damaging Het
Jak3 C A 8: 72,133,358 (GRCm39) C350* probably null Het
Jak3 A T 8: 72,136,059 (GRCm39) K620* probably null Het
Kcnq5 T C 1: 21,531,821 (GRCm39) S421G probably benign Het
Kdm2b A T 5: 123,021,428 (GRCm39) M50K probably damaging Het
Klk1b1 A G 7: 43,620,047 (GRCm39) D170G possibly damaging Het
Lama3 A T 18: 12,661,783 (GRCm39) T2160S probably benign Het
Lman1 A T 18: 66,131,423 (GRCm39) probably benign Het
Lmtk3 G A 7: 45,450,335 (GRCm39) probably null Het
Ltb A G 17: 35,414,739 (GRCm39) R180G probably damaging Het
Macf1 T A 4: 123,393,712 (GRCm39) probably null Het
Mast4 G T 13: 102,875,354 (GRCm39) P1146Q probably damaging Het
Micall2 C T 5: 139,697,317 (GRCm39) S678N probably damaging Het
Mon2 A T 10: 122,831,681 (GRCm39) I1675N probably damaging Het
Mug2 A G 6: 122,056,571 (GRCm39) N1172S probably benign Het
Naa30 C G 14: 49,410,556 (GRCm39) S161R possibly damaging Het
Ncaph T C 2: 126,966,795 (GRCm39) N220D probably damaging Het
Nell1 T C 7: 50,210,578 (GRCm39) V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 (GRCm38) N142S possibly damaging Het
Nin T A 12: 70,089,192 (GRCm39) T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 (GRCm38) noncoding transcript Het
Nrg1 T G 8: 32,408,043 (GRCm39) E63D probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or14j7 A G 17: 38,234,771 (GRCm39) T105A probably benign Het
Or5d39 T C 2: 87,979,487 (GRCm39) Y292C probably damaging Het
Or5g29 G A 2: 85,421,627 (GRCm39) V248I possibly damaging Het
Or5p53 C T 7: 107,532,868 (GRCm39) T47M probably benign Het
Or6ae1 T A 7: 139,742,737 (GRCm39) E42V probably damaging Het
Or7d11 A T 9: 19,965,892 (GRCm39) I289N probably damaging Het
Or7g27 A G 9: 19,250,352 (GRCm39) I199V probably benign Het
Or7g32 T A 9: 19,408,533 (GRCm39) V163E possibly damaging Het
Orc5 C T 5: 22,721,701 (GRCm39) probably null Het
Pard3 G A 8: 128,125,085 (GRCm39) R691Q probably benign Het
Pofut1 T A 2: 153,085,580 (GRCm39) D54E probably benign Het
Prl2c5 T A 13: 13,365,238 (GRCm39) V128E probably damaging Het
Ptk7 T C 17: 46,877,164 (GRCm39) M965V possibly damaging Het
Pum2 C T 12: 8,778,726 (GRCm39) R459* probably null Het
Pzp A T 6: 128,460,673 (GRCm39) N1494K probably benign Het
Rad21l A G 2: 151,487,349 (GRCm39) V545A probably benign Het
Rps6kc1 A T 1: 190,542,305 (GRCm39) M352K possibly damaging Het
Rpusd2 G A 2: 118,867,696 (GRCm39) probably null Het
Rsph14 A T 10: 74,865,603 (GRCm39) D78E probably damaging Het
Rtl9 A T X: 141,885,026 (GRCm39) M813L possibly damaging Het
Rtp4 A T 16: 23,431,690 (GRCm39) H74L probably damaging Het
Rusc1 G A 3: 88,995,155 (GRCm39) T725I possibly damaging Het
Rusf1 A G 7: 127,887,503 (GRCm39) L176P probably damaging Het
Ryr2 C T 13: 11,610,622 (GRCm39) C4068Y probably damaging Het
Ryr3 A G 2: 112,784,709 (GRCm39) V224A possibly damaging Het
Shprh A T 10: 11,027,864 (GRCm39) N157I probably benign Het
Siglece A G 7: 43,307,210 (GRCm39) I67T probably benign Het
Slc9b2 A T 3: 135,032,027 (GRCm39) T296S probably damaging Het
Sorbs2 A G 8: 46,228,666 (GRCm39) K276E probably damaging Het
Synj2 A G 17: 6,087,755 (GRCm39) T1269A probably benign Het
Taar7b T C 10: 23,876,573 (GRCm39) I246T possibly damaging Het
Taldo1 A G 7: 140,976,067 (GRCm39) Y113C probably damaging Het
Tarbp1 A T 8: 127,174,333 (GRCm39) probably null Het
Tars1 C T 15: 11,394,459 (GRCm39) M59I probably benign Het
Tas2r130 G A 6: 131,607,780 (GRCm39) T5I probably benign Het
Tex48 T C 4: 63,525,652 (GRCm39) E77G probably damaging Het
Tmco5 A G 2: 116,722,736 (GRCm39) R286G probably damaging Het
Trdmt1 A T 2: 13,524,725 (GRCm39) H243Q probably benign Het
Ttn T A 2: 76,564,638 (GRCm39) R26754* probably null Het
Ttn G A 2: 76,727,924 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,791,358 (GRCm39) L244R probably damaging Het
Ubxn1 C T 19: 8,850,930 (GRCm39) R115* probably null Het
Umod T G 7: 119,075,938 (GRCm39) N276T probably damaging Het
Unc13c A T 9: 73,572,938 (GRCm39) L1528Q probably damaging Het
Unc80 T A 1: 66,679,754 (GRCm39) H2108Q possibly damaging Het
Utp20 A C 10: 88,610,657 (GRCm39) D1442E probably damaging Het
Utp4 A G 8: 107,625,153 (GRCm39) Q144R probably benign Het
Vmn2r17 T A 5: 109,575,075 (GRCm39) N127K probably benign Het
Vmn2r75 T A 7: 85,814,372 (GRCm39) T374S probably benign Het
Washc5 A G 15: 59,222,257 (GRCm39) F523L probably damaging Het
Wdr3 A T 3: 100,067,213 (GRCm39) probably null Het
Wdr89 T C 12: 75,679,762 (GRCm39) Y164C probably damaging Het
Xpo5 T C 17: 46,536,017 (GRCm39) S550P probably damaging Het
Zfp69 T C 4: 120,788,029 (GRCm39) T429A probably damaging Het
Zfpm1 G T 8: 123,063,331 (GRCm39) G797C probably benign Het
Other mutations in Ltbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Ltbp4 APN 7 27,028,230 (GRCm39) missense probably damaging 0.96
IGL00585:Ltbp4 APN 7 27,026,158 (GRCm39) missense probably damaging 0.98
IGL01320:Ltbp4 APN 7 27,027,784 (GRCm39) splice site probably benign
IGL01860:Ltbp4 APN 7 27,019,071 (GRCm39) missense probably damaging 1.00
IGL02026:Ltbp4 APN 7 27,026,842 (GRCm39) nonsense probably null
IGL02226:Ltbp4 APN 7 27,006,359 (GRCm39) missense probably damaging 1.00
IGL02422:Ltbp4 APN 7 27,019,097 (GRCm39) missense probably damaging 1.00
IGL02611:Ltbp4 APN 7 27,010,080 (GRCm39) missense probably damaging 1.00
IGL02892:Ltbp4 APN 7 27,010,074 (GRCm39) missense probably damaging 1.00
IGL02926:Ltbp4 APN 7 27,028,297 (GRCm39) splice site probably null
IGL02950:Ltbp4 APN 7 27,006,143 (GRCm39) missense probably damaging 0.99
IGL03008:Ltbp4 APN 7 27,023,789 (GRCm39) missense probably damaging 0.99
IGL03271:Ltbp4 APN 7 27,029,240 (GRCm39) missense unknown
IGL02837:Ltbp4 UTSW 7 27,013,806 (GRCm39) missense probably damaging 1.00
R0792:Ltbp4 UTSW 7 27,024,485 (GRCm39) missense probably damaging 1.00
R0980:Ltbp4 UTSW 7 27,023,587 (GRCm39) missense probably damaging 1.00
R1017:Ltbp4 UTSW 7 27,005,501 (GRCm39) missense possibly damaging 0.95
R1185:Ltbp4 UTSW 7 27,009,960 (GRCm39) missense probably damaging 1.00
R1185:Ltbp4 UTSW 7 27,009,960 (GRCm39) missense probably damaging 1.00
R1185:Ltbp4 UTSW 7 27,009,960 (GRCm39) missense probably damaging 1.00
R1403:Ltbp4 UTSW 7 27,028,464 (GRCm39) missense unknown
R1403:Ltbp4 UTSW 7 27,028,464 (GRCm39) missense unknown
R1448:Ltbp4 UTSW 7 27,006,002 (GRCm39) missense possibly damaging 0.86
R1575:Ltbp4 UTSW 7 27,022,245 (GRCm39) missense probably damaging 1.00
R1918:Ltbp4 UTSW 7 27,036,994 (GRCm39) unclassified probably benign
R1932:Ltbp4 UTSW 7 27,007,191 (GRCm39) critical splice donor site probably null
R1959:Ltbp4 UTSW 7 27,028,443 (GRCm39) missense unknown
R1960:Ltbp4 UTSW 7 27,028,443 (GRCm39) missense unknown
R1976:Ltbp4 UTSW 7 27,026,195 (GRCm39) missense probably damaging 1.00
R2333:Ltbp4 UTSW 7 27,027,203 (GRCm39) missense possibly damaging 0.82
R2431:Ltbp4 UTSW 7 27,019,101 (GRCm39) missense possibly damaging 0.91
R3125:Ltbp4 UTSW 7 27,027,203 (GRCm39) missense possibly damaging 0.82
R4093:Ltbp4 UTSW 7 27,024,641 (GRCm39) missense possibly damaging 0.93
R4095:Ltbp4 UTSW 7 27,024,641 (GRCm39) missense possibly damaging 0.93
R4592:Ltbp4 UTSW 7 27,024,608 (GRCm39) missense probably damaging 0.96
R4610:Ltbp4 UTSW 7 27,006,125 (GRCm39) missense probably damaging 1.00
R4650:Ltbp4 UTSW 7 27,013,734 (GRCm39) missense probably damaging 1.00
R4912:Ltbp4 UTSW 7 27,005,541 (GRCm39) nonsense probably null
R5002:Ltbp4 UTSW 7 27,027,110 (GRCm39) frame shift probably null
R5016:Ltbp4 UTSW 7 27,027,110 (GRCm39) frame shift probably null
R5216:Ltbp4 UTSW 7 27,026,736 (GRCm39) small deletion probably benign
R5218:Ltbp4 UTSW 7 27,026,736 (GRCm39) small deletion probably benign
R5219:Ltbp4 UTSW 7 27,026,746 (GRCm39) missense probably benign 0.01
R5219:Ltbp4 UTSW 7 27,026,736 (GRCm39) small deletion probably benign
R5539:Ltbp4 UTSW 7 27,027,149 (GRCm39) missense probably damaging 0.97
R5991:Ltbp4 UTSW 7 27,008,741 (GRCm39) missense probably damaging 1.00
R6082:Ltbp4 UTSW 7 27,035,105 (GRCm39) unclassified probably benign
R6125:Ltbp4 UTSW 7 27,027,180 (GRCm39) missense probably damaging 1.00
R6146:Ltbp4 UTSW 7 27,019,149 (GRCm39) missense probably damaging 0.99
R6156:Ltbp4 UTSW 7 27,029,587 (GRCm39) missense unknown
R6414:Ltbp4 UTSW 7 27,010,140 (GRCm39) missense probably damaging 1.00
R6563:Ltbp4 UTSW 7 27,008,488 (GRCm39) missense probably damaging 1.00
R6719:Ltbp4 UTSW 7 27,028,188 (GRCm39) missense probably damaging 0.99
R6940:Ltbp4 UTSW 7 27,008,369 (GRCm39) missense probably damaging 1.00
R7054:Ltbp4 UTSW 7 27,007,191 (GRCm39) critical splice donor site probably null
R7116:Ltbp4 UTSW 7 27,004,852 (GRCm39) missense probably damaging 0.99
R7326:Ltbp4 UTSW 7 27,029,180 (GRCm39) missense unknown
R7419:Ltbp4 UTSW 7 27,029,192 (GRCm39) missense unknown
R8068:Ltbp4 UTSW 7 27,023,593 (GRCm39) missense probably damaging 0.99
R8435:Ltbp4 UTSW 7 27,034,870 (GRCm39) missense unknown
R8543:Ltbp4 UTSW 7 27,024,666 (GRCm39) missense possibly damaging 0.84
R8897:Ltbp4 UTSW 7 27,026,119 (GRCm39) missense probably benign 0.09
R9103:Ltbp4 UTSW 7 27,028,186 (GRCm39) missense unknown
R9131:Ltbp4 UTSW 7 27,036,976 (GRCm39) missense unknown
R9206:Ltbp4 UTSW 7 27,022,350 (GRCm39) missense probably damaging 1.00
R9301:Ltbp4 UTSW 7 27,021,578 (GRCm39) missense probably damaging 0.98
R9302:Ltbp4 UTSW 7 27,008,481 (GRCm39) missense possibly damaging 0.80
X0025:Ltbp4 UTSW 7 27,025,227 (GRCm39) missense probably damaging 1.00
X0066:Ltbp4 UTSW 7 27,005,490 (GRCm39) critical splice donor site probably null
Z1088:Ltbp4 UTSW 7 27,007,217 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGTGGTAACCCCTGTAATC -3'
(R):5'- AGTTCATCCTGGTAACTGCCTC -3'

Sequencing Primer
(F):5'- GAATTTCTGTGAGTTCCAAGCCAGC -3'
(R):5'- TGGTAACTGCCTCCCCCG -3'
Posted On 2014-09-17