Incidental Mutation 'R2060:C2cd3'
ID 228597
Institutional Source Beutler Lab
Gene Symbol C2cd3
Ensembl Gene ENSMUSG00000047248
Gene Name C2 calcium-dependent domain containing 3
Synonyms
MMRRC Submission 040065-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2060 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 100021440-100119359 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100104155 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 825 (I825T)
Ref Sequence ENSEMBL: ENSMUSP00000113728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000120196]
AlphaFold Q52KB6
Predicted Effect probably damaging
Transcript: ENSMUST00000051777
AA Change: I2056T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: I2056T

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
low complexity region 2180 2197 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098259
AA Change: I2056T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: I2056T

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119647
SMART Domains Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248

DomainStartEndE-ValueType
C2 61 199 2.36e1 SMART
C2 327 436 3.73e0 SMART
C2 526 666 1.47e1 SMART
C2 719 858 1.63e1 SMART
C2 1154 1261 1.43e-2 SMART
low complexity region 1429 1443 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120196
AA Change: I825T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248
AA Change: I825T

DomainStartEndE-ValueType
low complexity region 297 308 N/A INTRINSIC
C2 415 553 1.5e-1 SMART
C2 681 790 2.4e-2 SMART
C2 880 1020 9.5e-2 SMART
C2 1073 1212 1.1e-1 SMART
C2 1508 1615 9e-5 SMART
low complexity region 1783 1797 N/A INTRINSIC
low complexity region 1928 1940 N/A INTRINSIC
low complexity region 2001 2016 N/A INTRINSIC
low complexity region 2071 2087 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184657
Predicted Effect probably benign
Transcript: ENSMUST00000185084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193553
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 119,826,741 (GRCm39) W462* probably null Het
Aftph A T 11: 20,642,571 (GRCm39) Y821N probably damaging Het
Ahnak A T 19: 8,985,405 (GRCm39) M2230L probably benign Het
Arfgap1 T C 2: 180,614,575 (GRCm39) F144L probably benign Het
Arid4b C T 13: 14,370,037 (GRCm39) R1178C probably damaging Het
Asb8 A T 15: 98,039,254 (GRCm39) C49S possibly damaging Het
Baz1b A G 5: 135,233,968 (GRCm39) N165S probably damaging Het
Bod1l A T 5: 41,966,085 (GRCm39) I2660N possibly damaging Het
C4b A G 17: 34,955,075 (GRCm39) W804R probably damaging Het
Cadm3 A T 1: 173,171,969 (GRCm39) D201E probably damaging Het
Cdh17 T C 4: 11,803,982 (GRCm39) F552L probably benign Het
Cdh20 G C 1: 109,976,607 (GRCm39) A91P probably damaging Het
Cela1 A G 15: 100,573,203 (GRCm39) probably null Het
Clk3 T C 9: 57,658,400 (GRCm39) Y582C probably damaging Het
Cma1 C T 14: 56,181,155 (GRCm39) probably null Het
Ctcfl A G 2: 172,960,299 (GRCm39) S95P probably benign Het
Cylc1 C A X: 110,166,892 (GRCm39) T391K unknown Het
Cyp3a11 T A 5: 145,791,891 (GRCm39) I501L probably benign Het
Cyp3a59 T A 5: 146,041,524 (GRCm39) L356Q probably damaging Het
Dcdc2a A C 13: 25,291,693 (GRCm39) D226A possibly damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dlec1 A C 9: 118,941,154 (GRCm39) T235P probably damaging Het
Dnaaf1 G A 8: 120,317,341 (GRCm39) R290Q probably benign Het
Dnaaf5 C T 5: 139,163,758 (GRCm39) R377W probably damaging Het
Dpep1 T A 8: 123,927,130 (GRCm39) V293E probably damaging Het
Drosha T A 15: 12,924,245 (GRCm39) V1209E possibly damaging Het
Dync2h1 T G 9: 7,162,802 (GRCm39) I596L possibly damaging Het
Edem1 T A 6: 108,831,248 (GRCm39) Y570N probably damaging Het
Edrf1 G T 7: 133,258,858 (GRCm39) E9* probably null Het
Enpep T A 3: 129,074,172 (GRCm39) N792Y probably benign Het
Enpp2 A T 15: 54,739,110 (GRCm39) M391K probably damaging Het
Fanca A C 8: 124,001,220 (GRCm39) V1105G probably damaging Het
Fbxo22 T A 9: 55,125,667 (GRCm39) L74I probably damaging Het
Fchsd2 T A 7: 100,926,624 (GRCm39) F571L probably benign Het
Fhad1 T C 4: 141,626,560 (GRCm39) D1345G probably benign Het
G2e3 T C 12: 51,419,389 (GRCm39) F702L probably damaging Het
Glce A T 9: 61,968,228 (GRCm39) S308T possibly damaging Het
Glt1d1 A G 5: 127,734,183 (GRCm39) D119G probably benign Het
Gpr137c T C 14: 45,481,616 (GRCm39) I144T probably damaging Het
Gprin3 A G 6: 59,331,504 (GRCm39) C268R possibly damaging Het
Hadha G A 5: 30,333,834 (GRCm39) T395M probably benign Het
Hdhd2 T G 18: 77,052,738 (GRCm39) probably null Het
Homer2 C T 7: 81,268,451 (GRCm39) E70K probably benign Het
Hp1bp3 T A 4: 137,967,983 (GRCm39) D397E probably damaging Het
Hrh3 T C 2: 179,743,043 (GRCm39) N195S possibly damaging Het
Hyou1 T C 9: 44,292,849 (GRCm39) V153A probably benign Het
Igf2r A T 17: 12,920,206 (GRCm39) S1378T possibly damaging Het
Ints4 G A 7: 97,150,970 (GRCm39) R279H possibly damaging Het
Itga10 A T 3: 96,562,314 (GRCm39) R699* probably null Het
Itpkb A G 1: 180,249,423 (GRCm39) T933A probably benign Het
Itsn2 T G 12: 4,677,879 (GRCm39) F79V probably damaging Het
Jak3 C A 8: 72,133,358 (GRCm39) C350* probably null Het
Jak3 A T 8: 72,136,059 (GRCm39) K620* probably null Het
Kcnq5 T C 1: 21,531,821 (GRCm39) S421G probably benign Het
Kdm2b A T 5: 123,021,428 (GRCm39) M50K probably damaging Het
Klk1b1 A G 7: 43,620,047 (GRCm39) D170G possibly damaging Het
Lama3 A T 18: 12,661,783 (GRCm39) T2160S probably benign Het
Lman1 A T 18: 66,131,423 (GRCm39) probably benign Het
Lmtk3 G A 7: 45,450,335 (GRCm39) probably null Het
Ltb A G 17: 35,414,739 (GRCm39) R180G probably damaging Het
Ltbp4 C T 7: 27,008,378 (GRCm39) R1310Q probably damaging Het
Macf1 T A 4: 123,393,712 (GRCm39) probably null Het
Mast4 G T 13: 102,875,354 (GRCm39) P1146Q probably damaging Het
Micall2 C T 5: 139,697,317 (GRCm39) S678N probably damaging Het
Mon2 A T 10: 122,831,681 (GRCm39) I1675N probably damaging Het
Mug2 A G 6: 122,056,571 (GRCm39) N1172S probably benign Het
Naa30 C G 14: 49,410,556 (GRCm39) S161R possibly damaging Het
Ncaph T C 2: 126,966,795 (GRCm39) N220D probably damaging Het
Nell1 T C 7: 50,210,578 (GRCm39) V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 (GRCm38) N142S possibly damaging Het
Nin T A 12: 70,089,192 (GRCm39) T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 (GRCm38) noncoding transcript Het
Nrg1 T G 8: 32,408,043 (GRCm39) E63D probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or14j7 A G 17: 38,234,771 (GRCm39) T105A probably benign Het
Or5d39 T C 2: 87,979,487 (GRCm39) Y292C probably damaging Het
Or5g29 G A 2: 85,421,627 (GRCm39) V248I possibly damaging Het
Or5p53 C T 7: 107,532,868 (GRCm39) T47M probably benign Het
Or6ae1 T A 7: 139,742,737 (GRCm39) E42V probably damaging Het
Or7d11 A T 9: 19,965,892 (GRCm39) I289N probably damaging Het
Or7g27 A G 9: 19,250,352 (GRCm39) I199V probably benign Het
Or7g32 T A 9: 19,408,533 (GRCm39) V163E possibly damaging Het
Orc5 C T 5: 22,721,701 (GRCm39) probably null Het
Pard3 G A 8: 128,125,085 (GRCm39) R691Q probably benign Het
Pofut1 T A 2: 153,085,580 (GRCm39) D54E probably benign Het
Prl2c5 T A 13: 13,365,238 (GRCm39) V128E probably damaging Het
Ptk7 T C 17: 46,877,164 (GRCm39) M965V possibly damaging Het
Pum2 C T 12: 8,778,726 (GRCm39) R459* probably null Het
Pzp A T 6: 128,460,673 (GRCm39) N1494K probably benign Het
Rad21l A G 2: 151,487,349 (GRCm39) V545A probably benign Het
Rps6kc1 A T 1: 190,542,305 (GRCm39) M352K possibly damaging Het
Rpusd2 G A 2: 118,867,696 (GRCm39) probably null Het
Rsph14 A T 10: 74,865,603 (GRCm39) D78E probably damaging Het
Rtl9 A T X: 141,885,026 (GRCm39) M813L possibly damaging Het
Rtp4 A T 16: 23,431,690 (GRCm39) H74L probably damaging Het
Rusc1 G A 3: 88,995,155 (GRCm39) T725I possibly damaging Het
Rusf1 A G 7: 127,887,503 (GRCm39) L176P probably damaging Het
Ryr2 C T 13: 11,610,622 (GRCm39) C4068Y probably damaging Het
Ryr3 A G 2: 112,784,709 (GRCm39) V224A possibly damaging Het
Shprh A T 10: 11,027,864 (GRCm39) N157I probably benign Het
Siglece A G 7: 43,307,210 (GRCm39) I67T probably benign Het
Slc9b2 A T 3: 135,032,027 (GRCm39) T296S probably damaging Het
Sorbs2 A G 8: 46,228,666 (GRCm39) K276E probably damaging Het
Synj2 A G 17: 6,087,755 (GRCm39) T1269A probably benign Het
Taar7b T C 10: 23,876,573 (GRCm39) I246T possibly damaging Het
Taldo1 A G 7: 140,976,067 (GRCm39) Y113C probably damaging Het
Tarbp1 A T 8: 127,174,333 (GRCm39) probably null Het
Tars1 C T 15: 11,394,459 (GRCm39) M59I probably benign Het
Tas2r130 G A 6: 131,607,780 (GRCm39) T5I probably benign Het
Tex48 T C 4: 63,525,652 (GRCm39) E77G probably damaging Het
Tmco5 A G 2: 116,722,736 (GRCm39) R286G probably damaging Het
Trdmt1 A T 2: 13,524,725 (GRCm39) H243Q probably benign Het
Ttn T A 2: 76,564,638 (GRCm39) R26754* probably null Het
Ttn G A 2: 76,727,924 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,791,358 (GRCm39) L244R probably damaging Het
Ubxn1 C T 19: 8,850,930 (GRCm39) R115* probably null Het
Umod T G 7: 119,075,938 (GRCm39) N276T probably damaging Het
Unc13c A T 9: 73,572,938 (GRCm39) L1528Q probably damaging Het
Unc80 T A 1: 66,679,754 (GRCm39) H2108Q possibly damaging Het
Utp20 A C 10: 88,610,657 (GRCm39) D1442E probably damaging Het
Utp4 A G 8: 107,625,153 (GRCm39) Q144R probably benign Het
Vmn2r17 T A 5: 109,575,075 (GRCm39) N127K probably benign Het
Vmn2r75 T A 7: 85,814,372 (GRCm39) T374S probably benign Het
Washc5 A G 15: 59,222,257 (GRCm39) F523L probably damaging Het
Wdr3 A T 3: 100,067,213 (GRCm39) probably null Het
Wdr89 T C 12: 75,679,762 (GRCm39) Y164C probably damaging Het
Xpo5 T C 17: 46,536,017 (GRCm39) S550P probably damaging Het
Zfp69 T C 4: 120,788,029 (GRCm39) T429A probably damaging Het
Zfpm1 G T 8: 123,063,331 (GRCm39) G797C probably benign Het
Other mutations in C2cd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:C2cd3 APN 7 100,040,335 (GRCm39) missense probably benign 0.14
IGL01420:C2cd3 APN 7 100,104,065 (GRCm39) missense probably benign 0.35
IGL01775:C2cd3 APN 7 100,092,638 (GRCm39) missense probably damaging 1.00
IGL01832:C2cd3 APN 7 100,076,421 (GRCm39) missense possibly damaging 0.94
IGL01883:C2cd3 APN 7 100,023,693 (GRCm39) missense possibly damaging 0.80
IGL02664:C2cd3 APN 7 100,068,922 (GRCm39) missense possibly damaging 0.67
IGL02697:C2cd3 APN 7 100,076,376 (GRCm39) unclassified probably benign
IGL02852:C2cd3 APN 7 100,079,396 (GRCm39) missense probably damaging 1.00
IGL03158:C2cd3 APN 7 100,023,683 (GRCm39) missense probably damaging 1.00
R0012:C2cd3 UTSW 7 100,067,729 (GRCm39) missense possibly damaging 0.52
R0012:C2cd3 UTSW 7 100,067,729 (GRCm39) missense possibly damaging 0.52
R0013:C2cd3 UTSW 7 100,065,269 (GRCm39) missense probably damaging 1.00
R0013:C2cd3 UTSW 7 100,065,269 (GRCm39) missense probably damaging 1.00
R0032:C2cd3 UTSW 7 100,093,652 (GRCm39) unclassified probably benign
R0032:C2cd3 UTSW 7 100,093,652 (GRCm39) unclassified probably benign
R0124:C2cd3 UTSW 7 100,118,725 (GRCm39) missense probably benign
R0387:C2cd3 UTSW 7 100,071,714 (GRCm39) splice site probably benign
R0522:C2cd3 UTSW 7 100,044,429 (GRCm39) missense probably benign 0.14
R1124:C2cd3 UTSW 7 100,071,888 (GRCm39) missense probably benign 0.00
R1484:C2cd3 UTSW 7 100,089,397 (GRCm39) missense probably damaging 1.00
R1533:C2cd3 UTSW 7 100,055,284 (GRCm39) missense possibly damaging 0.54
R1631:C2cd3 UTSW 7 100,021,704 (GRCm39) critical splice donor site probably null
R1875:C2cd3 UTSW 7 100,056,232 (GRCm39) missense possibly damaging 0.89
R2059:C2cd3 UTSW 7 100,104,700 (GRCm39) unclassified probably benign
R2348:C2cd3 UTSW 7 100,062,573 (GRCm39) missense probably damaging 1.00
R3103:C2cd3 UTSW 7 100,044,459 (GRCm39) missense possibly damaging 0.47
R3405:C2cd3 UTSW 7 100,039,373 (GRCm39) missense probably benign 0.01
R3687:C2cd3 UTSW 7 100,085,040 (GRCm39) missense probably benign 0.28
R3775:C2cd3 UTSW 7 100,081,205 (GRCm39) missense probably damaging 1.00
R3854:C2cd3 UTSW 7 100,103,808 (GRCm39) critical splice acceptor site probably null
R4359:C2cd3 UTSW 7 100,090,296 (GRCm39) missense probably damaging 1.00
R4403:C2cd3 UTSW 7 100,081,306 (GRCm39) missense probably damaging 1.00
R4446:C2cd3 UTSW 7 100,023,684 (GRCm39) missense probably damaging 1.00
R4646:C2cd3 UTSW 7 100,021,657 (GRCm39) unclassified probably benign
R4705:C2cd3 UTSW 7 100,044,395 (GRCm39) missense possibly damaging 0.77
R4770:C2cd3 UTSW 7 100,092,642 (GRCm39) missense probably damaging 1.00
R4777:C2cd3 UTSW 7 100,065,539 (GRCm39) missense possibly damaging 0.46
R4816:C2cd3 UTSW 7 100,040,226 (GRCm39) missense probably benign 0.01
R4842:C2cd3 UTSW 7 100,065,397 (GRCm39) missense probably benign 0.00
R4858:C2cd3 UTSW 7 100,104,160 (GRCm39) missense probably damaging 1.00
R4871:C2cd3 UTSW 7 100,062,581 (GRCm39) missense possibly damaging 0.79
R4898:C2cd3 UTSW 7 100,055,166 (GRCm39) missense probably damaging 1.00
R5026:C2cd3 UTSW 7 100,109,049 (GRCm39) missense possibly damaging 0.52
R5112:C2cd3 UTSW 7 100,092,692 (GRCm39) missense possibly damaging 0.91
R5242:C2cd3 UTSW 7 100,039,373 (GRCm39) missense probably benign 0.01
R5538:C2cd3 UTSW 7 100,104,700 (GRCm39) critical splice donor site probably null
R5861:C2cd3 UTSW 7 100,093,682 (GRCm39) unclassified probably benign
R6110:C2cd3 UTSW 7 100,090,283 (GRCm39) missense probably damaging 1.00
R6326:C2cd3 UTSW 7 100,065,635 (GRCm39) missense probably benign 0.02
R6429:C2cd3 UTSW 7 100,081,298 (GRCm39) missense probably damaging 1.00
R6610:C2cd3 UTSW 7 100,104,505 (GRCm39) missense probably benign
R6613:C2cd3 UTSW 7 100,044,448 (GRCm39) missense possibly damaging 0.87
R6631:C2cd3 UTSW 7 100,067,747 (GRCm39) missense probably damaging 1.00
R6787:C2cd3 UTSW 7 100,104,553 (GRCm39) missense probably benign
R6837:C2cd3 UTSW 7 100,097,953 (GRCm39) missense probably damaging 1.00
R6849:C2cd3 UTSW 7 100,056,134 (GRCm39) missense probably damaging 1.00
R6860:C2cd3 UTSW 7 100,039,448 (GRCm39) missense probably benign 0.28
R6929:C2cd3 UTSW 7 100,100,826 (GRCm39) missense probably damaging 1.00
R7026:C2cd3 UTSW 7 100,081,299 (GRCm39) missense probably damaging 1.00
R7088:C2cd3 UTSW 7 100,065,388 (GRCm39) missense
R7174:C2cd3 UTSW 7 100,081,405 (GRCm39) missense
R7241:C2cd3 UTSW 7 100,056,257 (GRCm39) missense
R7335:C2cd3 UTSW 7 100,071,810 (GRCm39) missense
R7357:C2cd3 UTSW 7 100,079,310 (GRCm39) missense
R7493:C2cd3 UTSW 7 100,076,433 (GRCm39) missense
R7567:C2cd3 UTSW 7 100,080,022 (GRCm39) missense
R7573:C2cd3 UTSW 7 100,068,914 (GRCm39) missense
R7869:C2cd3 UTSW 7 100,118,698 (GRCm39) missense probably damaging 0.99
R7999:C2cd3 UTSW 7 100,109,096 (GRCm39) critical splice donor site probably null
R8134:C2cd3 UTSW 7 100,067,711 (GRCm39) missense
R8369:C2cd3 UTSW 7 100,044,465 (GRCm39) missense probably benign 0.03
R8372:C2cd3 UTSW 7 100,104,487 (GRCm39) nonsense probably null
R8753:C2cd3 UTSW 7 100,049,024 (GRCm39) critical splice donor site probably null
R8893:C2cd3 UTSW 7 100,104,004 (GRCm39) missense probably benign
R8905:C2cd3 UTSW 7 100,074,132 (GRCm39) critical splice donor site probably null
R8945:C2cd3 UTSW 7 100,040,286 (GRCm39) missense possibly damaging 0.88
R8970:C2cd3 UTSW 7 100,068,971 (GRCm39) missense
R9000:C2cd3 UTSW 7 100,065,281 (GRCm39) missense
R9064:C2cd3 UTSW 7 100,059,608 (GRCm39) missense
R9072:C2cd3 UTSW 7 100,040,291 (GRCm39) missense probably benign 0.07
R9126:C2cd3 UTSW 7 100,081,430 (GRCm39) missense
R9160:C2cd3 UTSW 7 100,075,236 (GRCm39) missense
R9234:C2cd3 UTSW 7 100,049,012 (GRCm39) missense
R9258:C2cd3 UTSW 7 100,098,026 (GRCm39) missense
R9295:C2cd3 UTSW 7 100,081,734 (GRCm39) missense
R9411:C2cd3 UTSW 7 100,065,704 (GRCm39) missense
R9420:C2cd3 UTSW 7 100,065,262 (GRCm39) missense
R9589:C2cd3 UTSW 7 100,081,756 (GRCm39) missense
R9628:C2cd3 UTSW 7 100,097,961 (GRCm39) missense
R9629:C2cd3 UTSW 7 100,029,249 (GRCm39) missense probably damaging 1.00
R9681:C2cd3 UTSW 7 100,023,662 (GRCm39) missense probably benign 0.32
R9775:C2cd3 UTSW 7 100,076,458 (GRCm39) missense
X0002:C2cd3 UTSW 7 100,089,442 (GRCm39) missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- ATAGAGGCGAGCACAGATTCC -3'
(R):5'- AAACACCACTTTGGCTAGGGG -3'

Sequencing Primer
(F):5'- GAGCACAGATTCCCTGCCTC -3'
(R):5'- CCTGTGCAGGCTGGGGG -3'
Posted On 2014-09-17