Incidental Mutation 'R2060:Sorbs2'
ID 228610
Institutional Source Beutler Lab
Gene Symbol Sorbs2
Ensembl Gene ENSMUSG00000031626
Gene Name sorbin and SH3 domain containing 2
Synonyms 2010203O03Rik, 9430041O17Rik
MMRRC Submission 040065-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2060 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 45960825-46280943 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46228666 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 276 (K276E)
Ref Sequence ENSEMBL: ENSMUSP00000123250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067065] [ENSMUST00000067107] [ENSMUST00000124544] [ENSMUST00000125295] [ENSMUST00000130011] [ENSMUST00000132139] [ENSMUST00000134675] [ENSMUST00000171337] [ENSMUST00000135336] [ENSMUST00000138049] [ENSMUST00000139869] [ENSMUST00000153798] [ENSMUST00000141039] [ENSMUST00000211095] [ENSMUST00000143820]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000067065
AA Change: K83E

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626
AA Change: K83E

DomainStartEndE-ValueType
low complexity region 48 61 N/A INTRINSIC
low complexity region 105 121 N/A INTRINSIC
low complexity region 136 154 N/A INTRINSIC
low complexity region 266 283 N/A INTRINSIC
low complexity region 362 373 N/A INTRINSIC
low complexity region 606 618 N/A INTRINSIC
low complexity region 619 630 N/A INTRINSIC
SH3 845 900 5.1e-23 SMART
low complexity region 901 916 N/A INTRINSIC
SH3 920 977 3.9e-19 SMART
SH3 1023 1079 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067107
AA Change: K299E

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000067641
Gene: ENSMUSG00000031626
AA Change: K299E

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124544
AA Change: K245E

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000125295
AA Change: K138E

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626
AA Change: K138E

DomainStartEndE-ValueType
Sorb 6 56 9.63e-34 SMART
low complexity region 103 116 N/A INTRINSIC
low complexity region 160 176 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
SH3 900 955 5.1e-23 SMART
low complexity region 956 971 N/A INTRINSIC
SH3 975 1032 3.9e-19 SMART
SH3 1078 1134 2.48e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130011
AA Change: K230E

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121619
Gene: ENSMUSG00000031626
AA Change: K230E

DomainStartEndE-ValueType
Sorb 113 163 1.01e-27 SMART
low complexity region 195 208 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 283 301 N/A INTRINSIC
low complexity region 366 383 N/A INTRINSIC
SH3 418 473 5.1e-23 SMART
low complexity region 474 489 N/A INTRINSIC
SH3 493 550 3.9e-19 SMART
SH3 596 652 2.48e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132139
AA Change: K276E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626
AA Change: K276E

DomainStartEndE-ValueType
Sorb 144 194 9.63e-34 SMART
low complexity region 241 254 N/A INTRINSIC
low complexity region 298 314 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
low complexity region 431 448 N/A INTRINSIC
SH3 483 538 5.1e-23 SMART
low complexity region 539 554 N/A INTRINSIC
SH3 558 615 3.9e-19 SMART
SH3 636 707 2.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132767
Predicted Effect probably damaging
Transcript: ENSMUST00000134675
AA Change: K276E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118160
Gene: ENSMUSG00000031626
AA Change: K276E

DomainStartEndE-ValueType
Sorb 144 194 9.63e-34 SMART
low complexity region 241 254 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171337
AA Change: K299E

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128000
Gene: ENSMUSG00000031626
AA Change: K299E

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 754 765 N/A INTRINSIC
SH3 980 1035 5.1e-23 SMART
low complexity region 1036 1051 N/A INTRINSIC
SH3 1055 1112 3.9e-19 SMART
SH3 1158 1214 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135336
AA Change: K299E

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114286
Gene: ENSMUSG00000031626
AA Change: K299E

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000138049
AA Change: K284E

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123503
Gene: ENSMUSG00000031626
AA Change: K284E

DomainStartEndE-ValueType
Sorb 167 217 1.01e-27 SMART
low complexity region 249 262 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139869
AA Change: K253E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121235
Gene: ENSMUSG00000031626
AA Change: K253E

DomainStartEndE-ValueType
Sorb 136 186 1.01e-27 SMART
low complexity region 218 231 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
SH3 389 444 5.1e-23 SMART
low complexity region 445 460 N/A INTRINSIC
SH3 464 521 3.9e-19 SMART
SH3 567 623 2.48e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000153798
AA Change: K268E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118353
Gene: ENSMUSG00000031626
AA Change: K268E

DomainStartEndE-ValueType
Sorb 136 186 9.63e-34 SMART
low complexity region 233 246 N/A INTRINSIC
low complexity region 351 368 N/A INTRINSIC
SH3 403 458 5.1e-23 SMART
low complexity region 459 474 N/A INTRINSIC
SH3 478 535 3.9e-19 SMART
Predicted Effect unknown
Transcript: ENSMUST00000155858
AA Change: K84E
SMART Domains Protein: ENSMUSP00000122820
Gene: ENSMUSG00000031626
AA Change: K84E

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
low complexity region 138 156 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140088
AA Change: K91E
SMART Domains Protein: ENSMUSP00000114158
Gene: ENSMUSG00000031626
AA Change: K91E

DomainStartEndE-ValueType
Sorb 2 25 9.17e-1 SMART
low complexity region 57 70 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141039
AA Change: K276E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117544
Gene: ENSMUSG00000031626
AA Change: K276E

DomainStartEndE-ValueType
Sorb 144 194 9.63e-34 SMART
low complexity region 241 254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209931
Predicted Effect probably benign
Transcript: ENSMUST00000211095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135116
Predicted Effect probably benign
Transcript: ENSMUST00000143820
SMART Domains Protein: ENSMUSP00000119539
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 113 163 9.63e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146627
SMART Domains Protein: ENSMUSP00000120487
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
low complexity region 41 59 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, reduced dendritic complexity, decreased excitatory synaptic transmission in dentate gyrus granule cells, a reduced acoustic startle response, and impaired long-term object recognition memory and contextual fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 119,826,741 (GRCm39) W462* probably null Het
Aftph A T 11: 20,642,571 (GRCm39) Y821N probably damaging Het
Ahnak A T 19: 8,985,405 (GRCm39) M2230L probably benign Het
Arfgap1 T C 2: 180,614,575 (GRCm39) F144L probably benign Het
Arid4b C T 13: 14,370,037 (GRCm39) R1178C probably damaging Het
Asb8 A T 15: 98,039,254 (GRCm39) C49S possibly damaging Het
Baz1b A G 5: 135,233,968 (GRCm39) N165S probably damaging Het
Bod1l A T 5: 41,966,085 (GRCm39) I2660N possibly damaging Het
C2cd3 T C 7: 100,104,155 (GRCm39) I825T probably damaging Het
C4b A G 17: 34,955,075 (GRCm39) W804R probably damaging Het
Cadm3 A T 1: 173,171,969 (GRCm39) D201E probably damaging Het
Cdh17 T C 4: 11,803,982 (GRCm39) F552L probably benign Het
Cdh20 G C 1: 109,976,607 (GRCm39) A91P probably damaging Het
Cela1 A G 15: 100,573,203 (GRCm39) probably null Het
Clk3 T C 9: 57,658,400 (GRCm39) Y582C probably damaging Het
Cma1 C T 14: 56,181,155 (GRCm39) probably null Het
Ctcfl A G 2: 172,960,299 (GRCm39) S95P probably benign Het
Cylc1 C A X: 110,166,892 (GRCm39) T391K unknown Het
Cyp3a11 T A 5: 145,791,891 (GRCm39) I501L probably benign Het
Cyp3a59 T A 5: 146,041,524 (GRCm39) L356Q probably damaging Het
Dcdc2a A C 13: 25,291,693 (GRCm39) D226A possibly damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dlec1 A C 9: 118,941,154 (GRCm39) T235P probably damaging Het
Dnaaf1 G A 8: 120,317,341 (GRCm39) R290Q probably benign Het
Dnaaf5 C T 5: 139,163,758 (GRCm39) R377W probably damaging Het
Dpep1 T A 8: 123,927,130 (GRCm39) V293E probably damaging Het
Drosha T A 15: 12,924,245 (GRCm39) V1209E possibly damaging Het
Dync2h1 T G 9: 7,162,802 (GRCm39) I596L possibly damaging Het
Edem1 T A 6: 108,831,248 (GRCm39) Y570N probably damaging Het
Edrf1 G T 7: 133,258,858 (GRCm39) E9* probably null Het
Enpep T A 3: 129,074,172 (GRCm39) N792Y probably benign Het
Enpp2 A T 15: 54,739,110 (GRCm39) M391K probably damaging Het
Fanca A C 8: 124,001,220 (GRCm39) V1105G probably damaging Het
Fbxo22 T A 9: 55,125,667 (GRCm39) L74I probably damaging Het
Fchsd2 T A 7: 100,926,624 (GRCm39) F571L probably benign Het
Fhad1 T C 4: 141,626,560 (GRCm39) D1345G probably benign Het
G2e3 T C 12: 51,419,389 (GRCm39) F702L probably damaging Het
Glce A T 9: 61,968,228 (GRCm39) S308T possibly damaging Het
Glt1d1 A G 5: 127,734,183 (GRCm39) D119G probably benign Het
Gpr137c T C 14: 45,481,616 (GRCm39) I144T probably damaging Het
Gprin3 A G 6: 59,331,504 (GRCm39) C268R possibly damaging Het
Hadha G A 5: 30,333,834 (GRCm39) T395M probably benign Het
Hdhd2 T G 18: 77,052,738 (GRCm39) probably null Het
Homer2 C T 7: 81,268,451 (GRCm39) E70K probably benign Het
Hp1bp3 T A 4: 137,967,983 (GRCm39) D397E probably damaging Het
Hrh3 T C 2: 179,743,043 (GRCm39) N195S possibly damaging Het
Hyou1 T C 9: 44,292,849 (GRCm39) V153A probably benign Het
Igf2r A T 17: 12,920,206 (GRCm39) S1378T possibly damaging Het
Ints4 G A 7: 97,150,970 (GRCm39) R279H possibly damaging Het
Itga10 A T 3: 96,562,314 (GRCm39) R699* probably null Het
Itpkb A G 1: 180,249,423 (GRCm39) T933A probably benign Het
Itsn2 T G 12: 4,677,879 (GRCm39) F79V probably damaging Het
Jak3 C A 8: 72,133,358 (GRCm39) C350* probably null Het
Jak3 A T 8: 72,136,059 (GRCm39) K620* probably null Het
Kcnq5 T C 1: 21,531,821 (GRCm39) S421G probably benign Het
Kdm2b A T 5: 123,021,428 (GRCm39) M50K probably damaging Het
Klk1b1 A G 7: 43,620,047 (GRCm39) D170G possibly damaging Het
Lama3 A T 18: 12,661,783 (GRCm39) T2160S probably benign Het
Lman1 A T 18: 66,131,423 (GRCm39) probably benign Het
Lmtk3 G A 7: 45,450,335 (GRCm39) probably null Het
Ltb A G 17: 35,414,739 (GRCm39) R180G probably damaging Het
Ltbp4 C T 7: 27,008,378 (GRCm39) R1310Q probably damaging Het
Macf1 T A 4: 123,393,712 (GRCm39) probably null Het
Mast4 G T 13: 102,875,354 (GRCm39) P1146Q probably damaging Het
Micall2 C T 5: 139,697,317 (GRCm39) S678N probably damaging Het
Mon2 A T 10: 122,831,681 (GRCm39) I1675N probably damaging Het
Mug2 A G 6: 122,056,571 (GRCm39) N1172S probably benign Het
Naa30 C G 14: 49,410,556 (GRCm39) S161R possibly damaging Het
Ncaph T C 2: 126,966,795 (GRCm39) N220D probably damaging Het
Nell1 T C 7: 50,210,578 (GRCm39) V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 (GRCm38) N142S possibly damaging Het
Nin T A 12: 70,089,192 (GRCm39) T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 (GRCm38) noncoding transcript Het
Nrg1 T G 8: 32,408,043 (GRCm39) E63D probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or14j7 A G 17: 38,234,771 (GRCm39) T105A probably benign Het
Or5d39 T C 2: 87,979,487 (GRCm39) Y292C probably damaging Het
Or5g29 G A 2: 85,421,627 (GRCm39) V248I possibly damaging Het
Or5p53 C T 7: 107,532,868 (GRCm39) T47M probably benign Het
Or6ae1 T A 7: 139,742,737 (GRCm39) E42V probably damaging Het
Or7d11 A T 9: 19,965,892 (GRCm39) I289N probably damaging Het
Or7g27 A G 9: 19,250,352 (GRCm39) I199V probably benign Het
Or7g32 T A 9: 19,408,533 (GRCm39) V163E possibly damaging Het
Orc5 C T 5: 22,721,701 (GRCm39) probably null Het
Pard3 G A 8: 128,125,085 (GRCm39) R691Q probably benign Het
Pofut1 T A 2: 153,085,580 (GRCm39) D54E probably benign Het
Prl2c5 T A 13: 13,365,238 (GRCm39) V128E probably damaging Het
Ptk7 T C 17: 46,877,164 (GRCm39) M965V possibly damaging Het
Pum2 C T 12: 8,778,726 (GRCm39) R459* probably null Het
Pzp A T 6: 128,460,673 (GRCm39) N1494K probably benign Het
Rad21l A G 2: 151,487,349 (GRCm39) V545A probably benign Het
Rps6kc1 A T 1: 190,542,305 (GRCm39) M352K possibly damaging Het
Rpusd2 G A 2: 118,867,696 (GRCm39) probably null Het
Rsph14 A T 10: 74,865,603 (GRCm39) D78E probably damaging Het
Rtl9 A T X: 141,885,026 (GRCm39) M813L possibly damaging Het
Rtp4 A T 16: 23,431,690 (GRCm39) H74L probably damaging Het
Rusc1 G A 3: 88,995,155 (GRCm39) T725I possibly damaging Het
Rusf1 A G 7: 127,887,503 (GRCm39) L176P probably damaging Het
Ryr2 C T 13: 11,610,622 (GRCm39) C4068Y probably damaging Het
Ryr3 A G 2: 112,784,709 (GRCm39) V224A possibly damaging Het
Shprh A T 10: 11,027,864 (GRCm39) N157I probably benign Het
Siglece A G 7: 43,307,210 (GRCm39) I67T probably benign Het
Slc9b2 A T 3: 135,032,027 (GRCm39) T296S probably damaging Het
Synj2 A G 17: 6,087,755 (GRCm39) T1269A probably benign Het
Taar7b T C 10: 23,876,573 (GRCm39) I246T possibly damaging Het
Taldo1 A G 7: 140,976,067 (GRCm39) Y113C probably damaging Het
Tarbp1 A T 8: 127,174,333 (GRCm39) probably null Het
Tars1 C T 15: 11,394,459 (GRCm39) M59I probably benign Het
Tas2r130 G A 6: 131,607,780 (GRCm39) T5I probably benign Het
Tex48 T C 4: 63,525,652 (GRCm39) E77G probably damaging Het
Tmco5 A G 2: 116,722,736 (GRCm39) R286G probably damaging Het
Trdmt1 A T 2: 13,524,725 (GRCm39) H243Q probably benign Het
Ttn T A 2: 76,564,638 (GRCm39) R26754* probably null Het
Ttn G A 2: 76,727,924 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,791,358 (GRCm39) L244R probably damaging Het
Ubxn1 C T 19: 8,850,930 (GRCm39) R115* probably null Het
Umod T G 7: 119,075,938 (GRCm39) N276T probably damaging Het
Unc13c A T 9: 73,572,938 (GRCm39) L1528Q probably damaging Het
Unc80 T A 1: 66,679,754 (GRCm39) H2108Q possibly damaging Het
Utp20 A C 10: 88,610,657 (GRCm39) D1442E probably damaging Het
Utp4 A G 8: 107,625,153 (GRCm39) Q144R probably benign Het
Vmn2r17 T A 5: 109,575,075 (GRCm39) N127K probably benign Het
Vmn2r75 T A 7: 85,814,372 (GRCm39) T374S probably benign Het
Washc5 A G 15: 59,222,257 (GRCm39) F523L probably damaging Het
Wdr3 A T 3: 100,067,213 (GRCm39) probably null Het
Wdr89 T C 12: 75,679,762 (GRCm39) Y164C probably damaging Het
Xpo5 T C 17: 46,536,017 (GRCm39) S550P probably damaging Het
Zfp69 T C 4: 120,788,029 (GRCm39) T429A probably damaging Het
Zfpm1 G T 8: 123,063,331 (GRCm39) G797C probably benign Het
Other mutations in Sorbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Sorbs2 APN 8 46,252,743 (GRCm39) splice site probably null
IGL00964:Sorbs2 APN 8 46,248,714 (GRCm39) missense probably damaging 0.97
IGL01101:Sorbs2 APN 8 46,198,460 (GRCm39) missense possibly damaging 0.93
IGL01586:Sorbs2 APN 8 46,248,631 (GRCm39) missense probably damaging 1.00
IGL01611:Sorbs2 APN 8 46,248,381 (GRCm39) missense probably null
IGL01662:Sorbs2 APN 8 46,256,866 (GRCm39) splice site probably benign
IGL01970:Sorbs2 APN 8 46,198,840 (GRCm39) missense probably damaging 1.00
IGL02169:Sorbs2 APN 8 46,276,786 (GRCm39) missense probably damaging 0.98
IGL02685:Sorbs2 APN 8 46,256,877 (GRCm39) missense probably benign 0.00
IGL03036:Sorbs2 APN 8 46,235,902 (GRCm39) missense probably benign
IGL03151:Sorbs2 APN 8 46,252,750 (GRCm39) missense probably benign 0.01
IGL03164:Sorbs2 APN 8 46,235,911 (GRCm39) missense probably benign 0.01
IGL03350:Sorbs2 APN 8 46,258,844 (GRCm39) missense probably damaging 0.99
BB001:Sorbs2 UTSW 8 46,248,507 (GRCm39) missense probably damaging 1.00
BB011:Sorbs2 UTSW 8 46,248,507 (GRCm39) missense probably damaging 1.00
R0058:Sorbs2 UTSW 8 46,249,300 (GRCm39) missense probably damaging 1.00
R0058:Sorbs2 UTSW 8 46,238,291 (GRCm39) splice site probably null
R0233:Sorbs2 UTSW 8 46,222,866 (GRCm39) missense probably damaging 1.00
R0233:Sorbs2 UTSW 8 46,222,866 (GRCm39) missense probably damaging 1.00
R0265:Sorbs2 UTSW 8 46,238,374 (GRCm39) splice site probably benign
R0306:Sorbs2 UTSW 8 46,248,767 (GRCm39) missense probably benign 0.00
R0308:Sorbs2 UTSW 8 46,248,167 (GRCm39) nonsense probably null
R0638:Sorbs2 UTSW 8 46,249,347 (GRCm39) missense probably damaging 1.00
R0940:Sorbs2 UTSW 8 46,249,539 (GRCm39) missense probably benign 0.39
R1110:Sorbs2 UTSW 8 46,248,767 (GRCm39) missense probably benign 0.13
R1160:Sorbs2 UTSW 8 46,223,613 (GRCm39) missense probably damaging 1.00
R1226:Sorbs2 UTSW 8 46,248,656 (GRCm39) missense probably damaging 1.00
R1271:Sorbs2 UTSW 8 46,249,004 (GRCm39) missense probably damaging 1.00
R1440:Sorbs2 UTSW 8 46,243,000 (GRCm39) splice site probably benign
R1514:Sorbs2 UTSW 8 46,222,866 (GRCm39) missense probably damaging 1.00
R1557:Sorbs2 UTSW 8 46,212,234 (GRCm39) splice site probably benign
R1582:Sorbs2 UTSW 8 46,258,814 (GRCm39) missense probably damaging 0.99
R1626:Sorbs2 UTSW 8 46,222,891 (GRCm39) missense probably damaging 1.00
R1700:Sorbs2 UTSW 8 46,254,021 (GRCm39) missense probably damaging 1.00
R1759:Sorbs2 UTSW 8 46,216,056 (GRCm39) makesense probably null
R1766:Sorbs2 UTSW 8 46,223,613 (GRCm39) missense probably damaging 1.00
R1782:Sorbs2 UTSW 8 46,258,733 (GRCm39) missense probably damaging 1.00
R1932:Sorbs2 UTSW 8 46,249,389 (GRCm39) missense probably benign 0.01
R1954:Sorbs2 UTSW 8 46,198,775 (GRCm39) missense probably benign 0.23
R2149:Sorbs2 UTSW 8 46,248,480 (GRCm39) missense probably damaging 0.99
R2568:Sorbs2 UTSW 8 46,248,407 (GRCm39) nonsense probably null
R3812:Sorbs2 UTSW 8 46,216,067 (GRCm39) missense probably benign 0.00
R3831:Sorbs2 UTSW 8 46,248,132 (GRCm39) missense probably damaging 1.00
R3975:Sorbs2 UTSW 8 46,225,747 (GRCm39) critical splice donor site probably null
R4033:Sorbs2 UTSW 8 46,228,632 (GRCm39) missense probably damaging 1.00
R4714:Sorbs2 UTSW 8 46,248,330 (GRCm39) missense possibly damaging 0.89
R4828:Sorbs2 UTSW 8 46,194,652 (GRCm39) intron probably benign
R4926:Sorbs2 UTSW 8 46,249,254 (GRCm39) missense probably benign 0.03
R5027:Sorbs2 UTSW 8 46,199,571 (GRCm39) splice site probably null
R5118:Sorbs2 UTSW 8 46,248,822 (GRCm39) missense probably damaging 1.00
R5159:Sorbs2 UTSW 8 46,248,767 (GRCm39) missense probably benign 0.00
R5342:Sorbs2 UTSW 8 46,249,050 (GRCm39) missense probably damaging 0.96
R5390:Sorbs2 UTSW 8 46,272,778 (GRCm39) missense probably damaging 1.00
R5436:Sorbs2 UTSW 8 46,249,038 (GRCm39) missense probably damaging 1.00
R5655:Sorbs2 UTSW 8 46,194,618 (GRCm39) critical splice donor site probably null
R5687:Sorbs2 UTSW 8 46,228,669 (GRCm39) missense probably damaging 1.00
R5695:Sorbs2 UTSW 8 46,245,912 (GRCm39) missense probably benign 0.27
R5733:Sorbs2 UTSW 8 46,212,226 (GRCm39) missense probably damaging 1.00
R5928:Sorbs2 UTSW 8 46,216,220 (GRCm39) missense probably damaging 1.00
R5949:Sorbs2 UTSW 8 46,222,934 (GRCm39) critical splice donor site probably null
R6341:Sorbs2 UTSW 8 46,223,615 (GRCm39) missense probably damaging 1.00
R6620:Sorbs2 UTSW 8 46,249,213 (GRCm39) missense probably damaging 1.00
R6761:Sorbs2 UTSW 8 46,225,651 (GRCm39) missense probably damaging 1.00
R7349:Sorbs2 UTSW 8 46,248,860 (GRCm39) nonsense probably null
R7404:Sorbs2 UTSW 8 46,212,233 (GRCm39) splice site probably null
R7524:Sorbs2 UTSW 8 46,248,693 (GRCm39) missense probably benign 0.00
R7809:Sorbs2 UTSW 8 46,198,465 (GRCm39) missense possibly damaging 0.93
R7820:Sorbs2 UTSW 8 46,249,593 (GRCm39) missense probably null 0.16
R7924:Sorbs2 UTSW 8 46,248,507 (GRCm39) missense probably damaging 1.00
R8285:Sorbs2 UTSW 8 46,249,104 (GRCm39) missense probably damaging 0.98
R8696:Sorbs2 UTSW 8 46,248,686 (GRCm39) missense possibly damaging 0.95
R8927:Sorbs2 UTSW 8 46,248,952 (GRCm39) missense probably damaging 1.00
R8928:Sorbs2 UTSW 8 46,248,952 (GRCm39) missense probably damaging 1.00
R9005:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9006:Sorbs2 UTSW 8 46,258,858 (GRCm39) missense possibly damaging 0.95
R9016:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9017:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9091:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9196:Sorbs2 UTSW 8 46,258,864 (GRCm39) missense probably benign 0.12
R9256:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9282:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9283:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9384:Sorbs2 UTSW 8 46,258,864 (GRCm39) missense probably benign 0.12
R9624:Sorbs2 UTSW 8 46,228,690 (GRCm39) missense possibly damaging 0.89
R9664:Sorbs2 UTSW 8 46,276,788 (GRCm39) missense probably benign 0.05
Z1176:Sorbs2 UTSW 8 46,243,062 (GRCm39) missense probably null 0.96
Z1177:Sorbs2 UTSW 8 46,235,996 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGAGAGCTGTTGTGTGAG -3'
(R):5'- GAGTGTTATGATTAGGCACAGC -3'

Sequencing Primer
(F):5'- TGAAGATCTGAGCTCGATCCCTAG -3'
(R):5'- TCTGAAACAAGATACACAAGACATGG -3'
Posted On 2014-09-17