Incidental Mutation 'R2060:Jak3'
ID 228612
Institutional Source Beutler Lab
Gene Symbol Jak3
Ensembl Gene ENSMUSG00000031805
Gene Name Janus kinase 3
Synonyms
MMRRC Submission 040065-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.702) question?
Stock # R2060 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 72129027-72143221 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 72136059 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 620 (K620*)
Ref Sequence ENSEMBL: ENSMUSP00000105640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051995] [ENSMUST00000110012] [ENSMUST00000110013]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000051995
AA Change: K620*
SMART Domains Protein: ENSMUSP00000060073
Gene: ENSMUSG00000031805
AA Change: K620*

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110012
AA Change: K620*
SMART Domains Protein: ENSMUSP00000105639
Gene: ENSMUSG00000031805
AA Change: K620*

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110013
AA Change: K620*
SMART Domains Protein: ENSMUSP00000105640
Gene: ENSMUSG00000031805
AA Change: K620*

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133263
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Janus kinase (JAK) family of tyrosine kinases involved in cytokine receptor-mediated intracellular signal transduction. It is predominantly expressed in immune cells and transduces a signal in response to its activation via tyrosine phosphorylation by interleukin receptors. Mutations in this gene are associated with autosomal SCID (severe combined immunodeficiency disease). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired B cell development, small thymi and T cell proliferate. Point mutation homozygotes develop autoimmune inflammatory bowel disease, decreased susceptibility to malaria infection and/or increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 119,826,741 (GRCm39) W462* probably null Het
Aftph A T 11: 20,642,571 (GRCm39) Y821N probably damaging Het
Ahnak A T 19: 8,985,405 (GRCm39) M2230L probably benign Het
Arfgap1 T C 2: 180,614,575 (GRCm39) F144L probably benign Het
Arid4b C T 13: 14,370,037 (GRCm39) R1178C probably damaging Het
Asb8 A T 15: 98,039,254 (GRCm39) C49S possibly damaging Het
Baz1b A G 5: 135,233,968 (GRCm39) N165S probably damaging Het
Bod1l A T 5: 41,966,085 (GRCm39) I2660N possibly damaging Het
C2cd3 T C 7: 100,104,155 (GRCm39) I825T probably damaging Het
C4b A G 17: 34,955,075 (GRCm39) W804R probably damaging Het
Cadm3 A T 1: 173,171,969 (GRCm39) D201E probably damaging Het
Cdh17 T C 4: 11,803,982 (GRCm39) F552L probably benign Het
Cdh20 G C 1: 109,976,607 (GRCm39) A91P probably damaging Het
Cela1 A G 15: 100,573,203 (GRCm39) probably null Het
Clk3 T C 9: 57,658,400 (GRCm39) Y582C probably damaging Het
Cma1 C T 14: 56,181,155 (GRCm39) probably null Het
Ctcfl A G 2: 172,960,299 (GRCm39) S95P probably benign Het
Cylc1 C A X: 110,166,892 (GRCm39) T391K unknown Het
Cyp3a11 T A 5: 145,791,891 (GRCm39) I501L probably benign Het
Cyp3a59 T A 5: 146,041,524 (GRCm39) L356Q probably damaging Het
Dcdc2a A C 13: 25,291,693 (GRCm39) D226A possibly damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dlec1 A C 9: 118,941,154 (GRCm39) T235P probably damaging Het
Dnaaf1 G A 8: 120,317,341 (GRCm39) R290Q probably benign Het
Dnaaf5 C T 5: 139,163,758 (GRCm39) R377W probably damaging Het
Dpep1 T A 8: 123,927,130 (GRCm39) V293E probably damaging Het
Drosha T A 15: 12,924,245 (GRCm39) V1209E possibly damaging Het
Dync2h1 T G 9: 7,162,802 (GRCm39) I596L possibly damaging Het
Edem1 T A 6: 108,831,248 (GRCm39) Y570N probably damaging Het
Edrf1 G T 7: 133,258,858 (GRCm39) E9* probably null Het
Enpep T A 3: 129,074,172 (GRCm39) N792Y probably benign Het
Enpp2 A T 15: 54,739,110 (GRCm39) M391K probably damaging Het
Fanca A C 8: 124,001,220 (GRCm39) V1105G probably damaging Het
Fbxo22 T A 9: 55,125,667 (GRCm39) L74I probably damaging Het
Fchsd2 T A 7: 100,926,624 (GRCm39) F571L probably benign Het
Fhad1 T C 4: 141,626,560 (GRCm39) D1345G probably benign Het
G2e3 T C 12: 51,419,389 (GRCm39) F702L probably damaging Het
Glce A T 9: 61,968,228 (GRCm39) S308T possibly damaging Het
Glt1d1 A G 5: 127,734,183 (GRCm39) D119G probably benign Het
Gpr137c T C 14: 45,481,616 (GRCm39) I144T probably damaging Het
Gprin3 A G 6: 59,331,504 (GRCm39) C268R possibly damaging Het
Hadha G A 5: 30,333,834 (GRCm39) T395M probably benign Het
Hdhd2 T G 18: 77,052,738 (GRCm39) probably null Het
Homer2 C T 7: 81,268,451 (GRCm39) E70K probably benign Het
Hp1bp3 T A 4: 137,967,983 (GRCm39) D397E probably damaging Het
Hrh3 T C 2: 179,743,043 (GRCm39) N195S possibly damaging Het
Hyou1 T C 9: 44,292,849 (GRCm39) V153A probably benign Het
Igf2r A T 17: 12,920,206 (GRCm39) S1378T possibly damaging Het
Ints4 G A 7: 97,150,970 (GRCm39) R279H possibly damaging Het
Itga10 A T 3: 96,562,314 (GRCm39) R699* probably null Het
Itpkb A G 1: 180,249,423 (GRCm39) T933A probably benign Het
Itsn2 T G 12: 4,677,879 (GRCm39) F79V probably damaging Het
Kcnq5 T C 1: 21,531,821 (GRCm39) S421G probably benign Het
Kdm2b A T 5: 123,021,428 (GRCm39) M50K probably damaging Het
Klk1b1 A G 7: 43,620,047 (GRCm39) D170G possibly damaging Het
Lama3 A T 18: 12,661,783 (GRCm39) T2160S probably benign Het
Lman1 A T 18: 66,131,423 (GRCm39) probably benign Het
Lmtk3 G A 7: 45,450,335 (GRCm39) probably null Het
Ltb A G 17: 35,414,739 (GRCm39) R180G probably damaging Het
Ltbp4 C T 7: 27,008,378 (GRCm39) R1310Q probably damaging Het
Macf1 T A 4: 123,393,712 (GRCm39) probably null Het
Mast4 G T 13: 102,875,354 (GRCm39) P1146Q probably damaging Het
Micall2 C T 5: 139,697,317 (GRCm39) S678N probably damaging Het
Mon2 A T 10: 122,831,681 (GRCm39) I1675N probably damaging Het
Mug2 A G 6: 122,056,571 (GRCm39) N1172S probably benign Het
Naa30 C G 14: 49,410,556 (GRCm39) S161R possibly damaging Het
Ncaph T C 2: 126,966,795 (GRCm39) N220D probably damaging Het
Nell1 T C 7: 50,210,578 (GRCm39) V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 (GRCm38) N142S possibly damaging Het
Nin T A 12: 70,089,192 (GRCm39) T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 (GRCm38) noncoding transcript Het
Nrg1 T G 8: 32,408,043 (GRCm39) E63D probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or14j7 A G 17: 38,234,771 (GRCm39) T105A probably benign Het
Or5d39 T C 2: 87,979,487 (GRCm39) Y292C probably damaging Het
Or5g29 G A 2: 85,421,627 (GRCm39) V248I possibly damaging Het
Or5p53 C T 7: 107,532,868 (GRCm39) T47M probably benign Het
Or6ae1 T A 7: 139,742,737 (GRCm39) E42V probably damaging Het
Or7d11 A T 9: 19,965,892 (GRCm39) I289N probably damaging Het
Or7g27 A G 9: 19,250,352 (GRCm39) I199V probably benign Het
Or7g32 T A 9: 19,408,533 (GRCm39) V163E possibly damaging Het
Orc5 C T 5: 22,721,701 (GRCm39) probably null Het
Pard3 G A 8: 128,125,085 (GRCm39) R691Q probably benign Het
Pofut1 T A 2: 153,085,580 (GRCm39) D54E probably benign Het
Prl2c5 T A 13: 13,365,238 (GRCm39) V128E probably damaging Het
Ptk7 T C 17: 46,877,164 (GRCm39) M965V possibly damaging Het
Pum2 C T 12: 8,778,726 (GRCm39) R459* probably null Het
Pzp A T 6: 128,460,673 (GRCm39) N1494K probably benign Het
Rad21l A G 2: 151,487,349 (GRCm39) V545A probably benign Het
Rps6kc1 A T 1: 190,542,305 (GRCm39) M352K possibly damaging Het
Rpusd2 G A 2: 118,867,696 (GRCm39) probably null Het
Rsph14 A T 10: 74,865,603 (GRCm39) D78E probably damaging Het
Rtl9 A T X: 141,885,026 (GRCm39) M813L possibly damaging Het
Rtp4 A T 16: 23,431,690 (GRCm39) H74L probably damaging Het
Rusc1 G A 3: 88,995,155 (GRCm39) T725I possibly damaging Het
Rusf1 A G 7: 127,887,503 (GRCm39) L176P probably damaging Het
Ryr2 C T 13: 11,610,622 (GRCm39) C4068Y probably damaging Het
Ryr3 A G 2: 112,784,709 (GRCm39) V224A possibly damaging Het
Shprh A T 10: 11,027,864 (GRCm39) N157I probably benign Het
Siglece A G 7: 43,307,210 (GRCm39) I67T probably benign Het
Slc9b2 A T 3: 135,032,027 (GRCm39) T296S probably damaging Het
Sorbs2 A G 8: 46,228,666 (GRCm39) K276E probably damaging Het
Synj2 A G 17: 6,087,755 (GRCm39) T1269A probably benign Het
Taar7b T C 10: 23,876,573 (GRCm39) I246T possibly damaging Het
Taldo1 A G 7: 140,976,067 (GRCm39) Y113C probably damaging Het
Tarbp1 A T 8: 127,174,333 (GRCm39) probably null Het
Tars1 C T 15: 11,394,459 (GRCm39) M59I probably benign Het
Tas2r130 G A 6: 131,607,780 (GRCm39) T5I probably benign Het
Tex48 T C 4: 63,525,652 (GRCm39) E77G probably damaging Het
Tmco5 A G 2: 116,722,736 (GRCm39) R286G probably damaging Het
Trdmt1 A T 2: 13,524,725 (GRCm39) H243Q probably benign Het
Ttn T A 2: 76,564,638 (GRCm39) R26754* probably null Het
Ttn G A 2: 76,727,924 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,791,358 (GRCm39) L244R probably damaging Het
Ubxn1 C T 19: 8,850,930 (GRCm39) R115* probably null Het
Umod T G 7: 119,075,938 (GRCm39) N276T probably damaging Het
Unc13c A T 9: 73,572,938 (GRCm39) L1528Q probably damaging Het
Unc80 T A 1: 66,679,754 (GRCm39) H2108Q possibly damaging Het
Utp20 A C 10: 88,610,657 (GRCm39) D1442E probably damaging Het
Utp4 A G 8: 107,625,153 (GRCm39) Q144R probably benign Het
Vmn2r17 T A 5: 109,575,075 (GRCm39) N127K probably benign Het
Vmn2r75 T A 7: 85,814,372 (GRCm39) T374S probably benign Het
Washc5 A G 15: 59,222,257 (GRCm39) F523L probably damaging Het
Wdr3 A T 3: 100,067,213 (GRCm39) probably null Het
Wdr89 T C 12: 75,679,762 (GRCm39) Y164C probably damaging Het
Xpo5 T C 17: 46,536,017 (GRCm39) S550P probably damaging Het
Zfp69 T C 4: 120,788,029 (GRCm39) T429A probably damaging Het
Zfpm1 G T 8: 123,063,331 (GRCm39) G797C probably benign Het
Other mutations in Jak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Jak3 APN 8 72,134,341 (GRCm39) splice site probably benign
IGL00720:Jak3 APN 8 72,136,681 (GRCm39) missense probably damaging 1.00
IGL00966:Jak3 APN 8 72,131,656 (GRCm39) missense probably benign 0.24
IGL01147:Jak3 APN 8 72,136,047 (GRCm39) missense probably benign
IGL01308:Jak3 APN 8 72,137,810 (GRCm39) missense probably damaging 1.00
IGL01328:Jak3 APN 8 72,132,264 (GRCm39) missense probably damaging 1.00
IGL01386:Jak3 APN 8 72,136,933 (GRCm39) missense probably damaging 1.00
IGL01515:Jak3 APN 8 72,133,206 (GRCm39) splice site probably null
IGL01870:Jak3 APN 8 72,133,434 (GRCm39) missense probably damaging 1.00
IGL02132:Jak3 APN 8 72,131,124 (GRCm39) missense probably damaging 0.99
IGL02413:Jak3 APN 8 72,138,763 (GRCm39) splice site probably null
IGL02752:Jak3 APN 8 72,135,595 (GRCm39) missense possibly damaging 0.50
IGL03089:Jak3 APN 8 72,138,727 (GRCm39) missense probably benign 0.15
IGL03177:Jak3 APN 8 72,135,014 (GRCm39) missense probably damaging 1.00
barbed UTSW 8 72,131,425 (GRCm39) missense possibly damaging 0.88
beanstalk UTSW 8 72,139,932 (GRCm39) missense probably benign 0.01
Bonis UTSW 8 72,131,898 (GRCm39) missense probably benign 0.05
citron UTSW 8 72,139,620 (GRCm39) splice site probably benign
corrupt UTSW 8 72,136,696 (GRCm39) missense probably damaging 1.00
daniels UTSW 8 72,134,299 (GRCm39) missense possibly damaging 0.48
Deposuit UTSW 8 72,138,048 (GRCm39) missense probably damaging 1.00
distortion UTSW 8 72,136,622 (GRCm39) missense probably damaging 1.00
Downcast UTSW 8 72,138,155 (GRCm39) missense probably benign 0.07
fake_news UTSW 8 72,138,601 (GRCm39) missense probably damaging 1.00
Implevit UTSW 8 72,131,417 (GRCm39) missense probably benign
mount_tai UTSW 8 72,136,021 (GRCm39) missense probably damaging 1.00
potentes UTSW 8 72,138,702 (GRCm39) missense probably damaging 0.99
Riot UTSW 8 72,134,960 (GRCm39) missense probably damaging 1.00
thistle UTSW 8 72,138,027 (GRCm39) critical splice acceptor site probably null
thistle2 UTSW 8 72,138,189 (GRCm39) missense probably damaging 1.00
PIT4403001:Jak3 UTSW 8 72,136,993 (GRCm39) missense probably benign 0.00
PIT4515001:Jak3 UTSW 8 72,132,286 (GRCm39) missense probably benign 0.21
R0013:Jak3 UTSW 8 72,136,971 (GRCm39) missense probably damaging 0.98
R0496:Jak3 UTSW 8 72,135,041 (GRCm39) missense probably damaging 1.00
R0522:Jak3 UTSW 8 72,134,918 (GRCm39) splice site probably benign
R0531:Jak3 UTSW 8 72,139,620 (GRCm39) splice site probably benign
R0538:Jak3 UTSW 8 72,138,126 (GRCm39) missense probably benign
R0612:Jak3 UTSW 8 72,136,021 (GRCm39) missense probably damaging 1.00
R0744:Jak3 UTSW 8 72,136,622 (GRCm39) missense probably damaging 1.00
R0833:Jak3 UTSW 8 72,136,622 (GRCm39) missense probably damaging 1.00
R0836:Jak3 UTSW 8 72,136,622 (GRCm39) missense probably damaging 1.00
R1183:Jak3 UTSW 8 72,137,194 (GRCm39) missense probably damaging 1.00
R1420:Jak3 UTSW 8 72,134,182 (GRCm39) missense possibly damaging 0.75
R1793:Jak3 UTSW 8 72,138,590 (GRCm39) splice site probably benign
R1967:Jak3 UTSW 8 72,134,179 (GRCm39) missense probably damaging 1.00
R1983:Jak3 UTSW 8 72,140,780 (GRCm39) missense probably benign
R1983:Jak3 UTSW 8 72,131,019 (GRCm39) missense possibly damaging 0.95
R2058:Jak3 UTSW 8 72,138,027 (GRCm39) critical splice acceptor site probably null
R2060:Jak3 UTSW 8 72,133,358 (GRCm39) nonsense probably null
R3705:Jak3 UTSW 8 72,134,166 (GRCm39) missense probably damaging 1.00
R3734:Jak3 UTSW 8 72,129,225 (GRCm39) unclassified probably benign
R4231:Jak3 UTSW 8 72,138,189 (GRCm39) missense probably damaging 1.00
R4596:Jak3 UTSW 8 72,137,275 (GRCm39) missense probably damaging 0.99
R4844:Jak3 UTSW 8 72,134,299 (GRCm39) missense possibly damaging 0.48
R4897:Jak3 UTSW 8 72,138,048 (GRCm39) missense probably damaging 1.00
R5038:Jak3 UTSW 8 72,138,702 (GRCm39) missense probably damaging 0.99
R5469:Jak3 UTSW 8 72,131,417 (GRCm39) missense probably benign
R5538:Jak3 UTSW 8 72,131,417 (GRCm39) missense probably benign
R5718:Jak3 UTSW 8 72,136,998 (GRCm39) missense probably damaging 1.00
R5799:Jak3 UTSW 8 72,131,344 (GRCm39) missense probably damaging 1.00
R5909:Jak3 UTSW 8 72,136,875 (GRCm39) missense possibly damaging 0.68
R5959:Jak3 UTSW 8 72,134,715 (GRCm39) missense probably damaging 1.00
R6260:Jak3 UTSW 8 72,131,954 (GRCm39) missense probably benign 0.00
R6798:Jak3 UTSW 8 72,133,615 (GRCm39) missense probably damaging 0.99
R7013:Jak3 UTSW 8 72,131,425 (GRCm39) missense possibly damaging 0.88
R7070:Jak3 UTSW 8 72,137,255 (GRCm39) missense probably damaging 1.00
R7122:Jak3 UTSW 8 72,138,601 (GRCm39) missense probably damaging 1.00
R7166:Jak3 UTSW 8 72,134,960 (GRCm39) missense probably damaging 1.00
R7225:Jak3 UTSW 8 72,138,155 (GRCm39) missense probably benign 0.07
R7440:Jak3 UTSW 8 72,133,362 (GRCm39) missense probably benign 0.02
R7489:Jak3 UTSW 8 72,136,936 (GRCm39) missense probably damaging 1.00
R7773:Jak3 UTSW 8 72,131,686 (GRCm39) missense probably benign
R7779:Jak3 UTSW 8 72,139,932 (GRCm39) missense probably benign 0.01
R8511:Jak3 UTSW 8 72,138,194 (GRCm39) missense probably damaging 1.00
R8808:Jak3 UTSW 8 72,138,164 (GRCm39) missense possibly damaging 0.71
R8859:Jak3 UTSW 8 72,131,160 (GRCm39) missense probably benign 0.37
R9079:Jak3 UTSW 8 72,131,898 (GRCm39) missense probably benign 0.05
R9320:Jak3 UTSW 8 72,134,265 (GRCm39) missense probably benign 0.03
R9389:Jak3 UTSW 8 72,136,696 (GRCm39) missense probably damaging 1.00
R9664:Jak3 UTSW 8 72,131,366 (GRCm39) missense probably damaging 1.00
Z1176:Jak3 UTSW 8 72,133,327 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TAGGAAACAGAAGTCCAGCCTG -3'
(R):5'- ATGGGTTCACAGTGCTCTCC -3'

Sequencing Primer
(F):5'- AGTCCAGCCTGTGCAAAG -3'
(R):5'- TGACACTTACAGCCCTCTGAG -3'
Posted On 2014-09-17