Incidental Mutation 'R2060:Fanca'
ID 228617
Institutional Source Beutler Lab
Gene Symbol Fanca
Ensembl Gene ENSMUSG00000032815
Gene Name Fanconi anemia, complementation group A
Synonyms
MMRRC Submission 040065-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.678) question?
Stock # R2060 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 123995039-124045315 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 124001220 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 1105 (V1105G)
Ref Sequence ENSEMBL: ENSMUSP00000045217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001092] [ENSMUST00000035495] [ENSMUST00000127664]
AlphaFold Q9JL70
Predicted Effect probably benign
Transcript: ENSMUST00000001092
SMART Domains Protein: ENSMUSP00000001092
Gene: ENSMUSG00000001065

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:zf-AD 79 159 1.2e-13 PFAM
low complexity region 402 422 N/A INTRINSIC
ZnF_C2H2 434 458 2.24e-3 SMART
ZnF_C2H2 465 490 6.67e-2 SMART
ZnF_C2H2 496 518 1.38e-3 SMART
ZnF_C2H2 524 546 1.82e-3 SMART
ZnF_C2H2 554 577 4.79e-3 SMART
low complexity region 586 602 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000035495
AA Change: V1105G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815
AA Change: V1105G

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 78 100 N/A INTRINSIC
Pfam:Fanconi_A_N 167 520 3.7e-146 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 1069 1079 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
Pfam:Fanconi_A 1246 1308 8.4e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126834
SMART Domains Protein: ENSMUSP00000116732
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 142 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155279
Predicted Effect probably benign
Transcript: ENSMUST00000213090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155510
SMART Domains Protein: ENSMUSP00000118712
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 54 64 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 119,826,741 (GRCm39) W462* probably null Het
Aftph A T 11: 20,642,571 (GRCm39) Y821N probably damaging Het
Ahnak A T 19: 8,985,405 (GRCm39) M2230L probably benign Het
Arfgap1 T C 2: 180,614,575 (GRCm39) F144L probably benign Het
Arid4b C T 13: 14,370,037 (GRCm39) R1178C probably damaging Het
Asb8 A T 15: 98,039,254 (GRCm39) C49S possibly damaging Het
Baz1b A G 5: 135,233,968 (GRCm39) N165S probably damaging Het
Bod1l A T 5: 41,966,085 (GRCm39) I2660N possibly damaging Het
C2cd3 T C 7: 100,104,155 (GRCm39) I825T probably damaging Het
C4b A G 17: 34,955,075 (GRCm39) W804R probably damaging Het
Cadm3 A T 1: 173,171,969 (GRCm39) D201E probably damaging Het
Cdh17 T C 4: 11,803,982 (GRCm39) F552L probably benign Het
Cdh20 G C 1: 109,976,607 (GRCm39) A91P probably damaging Het
Cela1 A G 15: 100,573,203 (GRCm39) probably null Het
Clk3 T C 9: 57,658,400 (GRCm39) Y582C probably damaging Het
Cma1 C T 14: 56,181,155 (GRCm39) probably null Het
Ctcfl A G 2: 172,960,299 (GRCm39) S95P probably benign Het
Cylc1 C A X: 110,166,892 (GRCm39) T391K unknown Het
Cyp3a11 T A 5: 145,791,891 (GRCm39) I501L probably benign Het
Cyp3a59 T A 5: 146,041,524 (GRCm39) L356Q probably damaging Het
Dcdc2a A C 13: 25,291,693 (GRCm39) D226A possibly damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dlec1 A C 9: 118,941,154 (GRCm39) T235P probably damaging Het
Dnaaf1 G A 8: 120,317,341 (GRCm39) R290Q probably benign Het
Dnaaf5 C T 5: 139,163,758 (GRCm39) R377W probably damaging Het
Dpep1 T A 8: 123,927,130 (GRCm39) V293E probably damaging Het
Drosha T A 15: 12,924,245 (GRCm39) V1209E possibly damaging Het
Dync2h1 T G 9: 7,162,802 (GRCm39) I596L possibly damaging Het
Edem1 T A 6: 108,831,248 (GRCm39) Y570N probably damaging Het
Edrf1 G T 7: 133,258,858 (GRCm39) E9* probably null Het
Enpep T A 3: 129,074,172 (GRCm39) N792Y probably benign Het
Enpp2 A T 15: 54,739,110 (GRCm39) M391K probably damaging Het
Fbxo22 T A 9: 55,125,667 (GRCm39) L74I probably damaging Het
Fchsd2 T A 7: 100,926,624 (GRCm39) F571L probably benign Het
Fhad1 T C 4: 141,626,560 (GRCm39) D1345G probably benign Het
G2e3 T C 12: 51,419,389 (GRCm39) F702L probably damaging Het
Glce A T 9: 61,968,228 (GRCm39) S308T possibly damaging Het
Glt1d1 A G 5: 127,734,183 (GRCm39) D119G probably benign Het
Gpr137c T C 14: 45,481,616 (GRCm39) I144T probably damaging Het
Gprin3 A G 6: 59,331,504 (GRCm39) C268R possibly damaging Het
Hadha G A 5: 30,333,834 (GRCm39) T395M probably benign Het
Hdhd2 T G 18: 77,052,738 (GRCm39) probably null Het
Homer2 C T 7: 81,268,451 (GRCm39) E70K probably benign Het
Hp1bp3 T A 4: 137,967,983 (GRCm39) D397E probably damaging Het
Hrh3 T C 2: 179,743,043 (GRCm39) N195S possibly damaging Het
Hyou1 T C 9: 44,292,849 (GRCm39) V153A probably benign Het
Igf2r A T 17: 12,920,206 (GRCm39) S1378T possibly damaging Het
Ints4 G A 7: 97,150,970 (GRCm39) R279H possibly damaging Het
Itga10 A T 3: 96,562,314 (GRCm39) R699* probably null Het
Itpkb A G 1: 180,249,423 (GRCm39) T933A probably benign Het
Itsn2 T G 12: 4,677,879 (GRCm39) F79V probably damaging Het
Jak3 C A 8: 72,133,358 (GRCm39) C350* probably null Het
Jak3 A T 8: 72,136,059 (GRCm39) K620* probably null Het
Kcnq5 T C 1: 21,531,821 (GRCm39) S421G probably benign Het
Kdm2b A T 5: 123,021,428 (GRCm39) M50K probably damaging Het
Klk1b1 A G 7: 43,620,047 (GRCm39) D170G possibly damaging Het
Lama3 A T 18: 12,661,783 (GRCm39) T2160S probably benign Het
Lman1 A T 18: 66,131,423 (GRCm39) probably benign Het
Lmtk3 G A 7: 45,450,335 (GRCm39) probably null Het
Ltb A G 17: 35,414,739 (GRCm39) R180G probably damaging Het
Ltbp4 C T 7: 27,008,378 (GRCm39) R1310Q probably damaging Het
Macf1 T A 4: 123,393,712 (GRCm39) probably null Het
Mast4 G T 13: 102,875,354 (GRCm39) P1146Q probably damaging Het
Micall2 C T 5: 139,697,317 (GRCm39) S678N probably damaging Het
Mon2 A T 10: 122,831,681 (GRCm39) I1675N probably damaging Het
Mug2 A G 6: 122,056,571 (GRCm39) N1172S probably benign Het
Naa30 C G 14: 49,410,556 (GRCm39) S161R possibly damaging Het
Ncaph T C 2: 126,966,795 (GRCm39) N220D probably damaging Het
Nell1 T C 7: 50,210,578 (GRCm39) V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 (GRCm38) N142S possibly damaging Het
Nin T A 12: 70,089,192 (GRCm39) T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 (GRCm38) noncoding transcript Het
Nrg1 T G 8: 32,408,043 (GRCm39) E63D probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or14j7 A G 17: 38,234,771 (GRCm39) T105A probably benign Het
Or5d39 T C 2: 87,979,487 (GRCm39) Y292C probably damaging Het
Or5g29 G A 2: 85,421,627 (GRCm39) V248I possibly damaging Het
Or5p53 C T 7: 107,532,868 (GRCm39) T47M probably benign Het
Or6ae1 T A 7: 139,742,737 (GRCm39) E42V probably damaging Het
Or7d11 A T 9: 19,965,892 (GRCm39) I289N probably damaging Het
Or7g27 A G 9: 19,250,352 (GRCm39) I199V probably benign Het
Or7g32 T A 9: 19,408,533 (GRCm39) V163E possibly damaging Het
Orc5 C T 5: 22,721,701 (GRCm39) probably null Het
Pard3 G A 8: 128,125,085 (GRCm39) R691Q probably benign Het
Pofut1 T A 2: 153,085,580 (GRCm39) D54E probably benign Het
Prl2c5 T A 13: 13,365,238 (GRCm39) V128E probably damaging Het
Ptk7 T C 17: 46,877,164 (GRCm39) M965V possibly damaging Het
Pum2 C T 12: 8,778,726 (GRCm39) R459* probably null Het
Pzp A T 6: 128,460,673 (GRCm39) N1494K probably benign Het
Rad21l A G 2: 151,487,349 (GRCm39) V545A probably benign Het
Rps6kc1 A T 1: 190,542,305 (GRCm39) M352K possibly damaging Het
Rpusd2 G A 2: 118,867,696 (GRCm39) probably null Het
Rsph14 A T 10: 74,865,603 (GRCm39) D78E probably damaging Het
Rtl9 A T X: 141,885,026 (GRCm39) M813L possibly damaging Het
Rtp4 A T 16: 23,431,690 (GRCm39) H74L probably damaging Het
Rusc1 G A 3: 88,995,155 (GRCm39) T725I possibly damaging Het
Rusf1 A G 7: 127,887,503 (GRCm39) L176P probably damaging Het
Ryr2 C T 13: 11,610,622 (GRCm39) C4068Y probably damaging Het
Ryr3 A G 2: 112,784,709 (GRCm39) V224A possibly damaging Het
Shprh A T 10: 11,027,864 (GRCm39) N157I probably benign Het
Siglece A G 7: 43,307,210 (GRCm39) I67T probably benign Het
Slc9b2 A T 3: 135,032,027 (GRCm39) T296S probably damaging Het
Sorbs2 A G 8: 46,228,666 (GRCm39) K276E probably damaging Het
Synj2 A G 17: 6,087,755 (GRCm39) T1269A probably benign Het
Taar7b T C 10: 23,876,573 (GRCm39) I246T possibly damaging Het
Taldo1 A G 7: 140,976,067 (GRCm39) Y113C probably damaging Het
Tarbp1 A T 8: 127,174,333 (GRCm39) probably null Het
Tars1 C T 15: 11,394,459 (GRCm39) M59I probably benign Het
Tas2r130 G A 6: 131,607,780 (GRCm39) T5I probably benign Het
Tex48 T C 4: 63,525,652 (GRCm39) E77G probably damaging Het
Tmco5 A G 2: 116,722,736 (GRCm39) R286G probably damaging Het
Trdmt1 A T 2: 13,524,725 (GRCm39) H243Q probably benign Het
Ttn T A 2: 76,564,638 (GRCm39) R26754* probably null Het
Ttn G A 2: 76,727,924 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,791,358 (GRCm39) L244R probably damaging Het
Ubxn1 C T 19: 8,850,930 (GRCm39) R115* probably null Het
Umod T G 7: 119,075,938 (GRCm39) N276T probably damaging Het
Unc13c A T 9: 73,572,938 (GRCm39) L1528Q probably damaging Het
Unc80 T A 1: 66,679,754 (GRCm39) H2108Q possibly damaging Het
Utp20 A C 10: 88,610,657 (GRCm39) D1442E probably damaging Het
Utp4 A G 8: 107,625,153 (GRCm39) Q144R probably benign Het
Vmn2r17 T A 5: 109,575,075 (GRCm39) N127K probably benign Het
Vmn2r75 T A 7: 85,814,372 (GRCm39) T374S probably benign Het
Washc5 A G 15: 59,222,257 (GRCm39) F523L probably damaging Het
Wdr3 A T 3: 100,067,213 (GRCm39) probably null Het
Wdr89 T C 12: 75,679,762 (GRCm39) Y164C probably damaging Het
Xpo5 T C 17: 46,536,017 (GRCm39) S550P probably damaging Het
Zfp69 T C 4: 120,788,029 (GRCm39) T429A probably damaging Het
Zfpm1 G T 8: 123,063,331 (GRCm39) G797C probably benign Het
Other mutations in Fanca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02348:Fanca APN 8 124,032,002 (GRCm39) missense probably damaging 1.00
IGL02805:Fanca APN 8 124,016,233 (GRCm39) missense probably damaging 0.99
IGL03280:Fanca APN 8 124,043,198 (GRCm39) unclassified probably benign
PIT4402001:Fanca UTSW 8 124,039,803 (GRCm39) missense possibly damaging 0.83
R0114:Fanca UTSW 8 124,015,230 (GRCm39) splice site probably null
R0115:Fanca UTSW 8 123,995,278 (GRCm39) missense probably benign 0.00
R0271:Fanca UTSW 8 123,999,180 (GRCm39) unclassified probably benign
R0330:Fanca UTSW 8 124,000,911 (GRCm39) nonsense probably null
R0345:Fanca UTSW 8 124,031,552 (GRCm39) missense probably damaging 1.00
R0570:Fanca UTSW 8 124,033,169 (GRCm39) missense probably benign 0.01
R0601:Fanca UTSW 8 124,035,252 (GRCm39) missense probably damaging 0.99
R0617:Fanca UTSW 8 124,014,809 (GRCm39) missense probably damaging 0.99
R0639:Fanca UTSW 8 124,016,098 (GRCm39) critical splice donor site probably null
R0943:Fanca UTSW 8 124,000,925 (GRCm39) missense probably damaging 1.00
R1140:Fanca UTSW 8 124,039,868 (GRCm39) splice site probably null
R1364:Fanca UTSW 8 124,031,020 (GRCm39) splice site probably benign
R1366:Fanca UTSW 8 124,031,020 (GRCm39) splice site probably benign
R1367:Fanca UTSW 8 124,031,020 (GRCm39) splice site probably benign
R1368:Fanca UTSW 8 124,031,020 (GRCm39) splice site probably benign
R1969:Fanca UTSW 8 124,014,803 (GRCm39) missense probably benign 0.41
R1992:Fanca UTSW 8 124,024,551 (GRCm39) missense possibly damaging 0.94
R2174:Fanca UTSW 8 123,998,009 (GRCm39) missense probably benign 0.00
R2261:Fanca UTSW 8 124,016,098 (GRCm39) critical splice donor site probably null
R3957:Fanca UTSW 8 124,043,102 (GRCm39) missense probably benign 0.00
R4062:Fanca UTSW 8 124,001,911 (GRCm39) missense probably benign 0.00
R4153:Fanca UTSW 8 124,031,617 (GRCm39) missense possibly damaging 0.89
R4270:Fanca UTSW 8 123,995,533 (GRCm39) missense probably damaging 1.00
R4424:Fanca UTSW 8 124,015,532 (GRCm39) missense probably benign 0.11
R4581:Fanca UTSW 8 124,001,077 (GRCm39) splice site probably null
R4639:Fanca UTSW 8 124,044,889 (GRCm39) missense probably damaging 0.98
R4664:Fanca UTSW 8 123,995,711 (GRCm39) missense probably damaging 0.99
R4665:Fanca UTSW 8 123,995,711 (GRCm39) missense probably damaging 0.99
R4666:Fanca UTSW 8 123,995,711 (GRCm39) missense probably damaging 0.99
R4686:Fanca UTSW 8 123,995,673 (GRCm39) splice site probably benign
R4775:Fanca UTSW 8 124,023,045 (GRCm39) missense probably damaging 0.99
R4782:Fanca UTSW 8 124,014,941 (GRCm39) missense probably damaging 1.00
R4799:Fanca UTSW 8 124,014,941 (GRCm39) missense probably damaging 1.00
R4926:Fanca UTSW 8 124,030,724 (GRCm39) missense probably benign 0.05
R4973:Fanca UTSW 8 124,035,261 (GRCm39) missense probably damaging 0.96
R5039:Fanca UTSW 8 124,010,785 (GRCm39) missense probably benign
R5195:Fanca UTSW 8 124,030,684 (GRCm39) intron probably benign
R5590:Fanca UTSW 8 124,030,702 (GRCm39) intron probably benign
R5848:Fanca UTSW 8 124,021,792 (GRCm39) intron probably benign
R5965:Fanca UTSW 8 124,043,149 (GRCm39) missense possibly damaging 0.46
R6224:Fanca UTSW 8 124,032,020 (GRCm39) missense possibly damaging 0.87
R6385:Fanca UTSW 8 124,032,606 (GRCm39) splice site probably null
R6762:Fanca UTSW 8 123,998,042 (GRCm39) missense probably benign 0.26
R6795:Fanca UTSW 8 124,045,232 (GRCm39) missense probably benign 0.02
R6810:Fanca UTSW 8 124,013,216 (GRCm39) missense probably damaging 0.99
R7153:Fanca UTSW 8 124,043,164 (GRCm39) missense probably damaging 1.00
R7170:Fanca UTSW 8 123,997,945 (GRCm39) missense probably damaging 1.00
R7204:Fanca UTSW 8 124,013,216 (GRCm39) missense probably damaging 0.98
R7366:Fanca UTSW 8 124,007,952 (GRCm39) missense probably benign 0.08
R7599:Fanca UTSW 8 123,997,999 (GRCm39) missense probably benign
R7639:Fanca UTSW 8 124,018,134 (GRCm39) critical splice donor site probably null
R7650:Fanca UTSW 8 123,995,303 (GRCm39) splice site probably null
R8066:Fanca UTSW 8 124,030,679 (GRCm39) missense unknown
R8247:Fanca UTSW 8 124,010,694 (GRCm39) unclassified probably benign
R8312:Fanca UTSW 8 123,996,549 (GRCm39) intron probably benign
R8327:Fanca UTSW 8 124,039,984 (GRCm39) nonsense probably null
R8719:Fanca UTSW 8 124,014,867 (GRCm39) missense probably benign 0.00
R8826:Fanca UTSW 8 123,995,209 (GRCm39) missense probably benign 0.07
R8987:Fanca UTSW 8 124,024,538 (GRCm39) missense probably damaging 1.00
R9017:Fanca UTSW 8 124,035,307 (GRCm39) missense possibly damaging 0.69
R9319:Fanca UTSW 8 124,018,190 (GRCm39) missense probably benign
R9471:Fanca UTSW 8 124,000,897 (GRCm39) missense possibly damaging 0.88
R9542:Fanca UTSW 8 124,023,078 (GRCm39) missense probably damaging 0.98
R9656:Fanca UTSW 8 124,031,482 (GRCm39) missense probably benign 0.02
R9708:Fanca UTSW 8 124,001,263 (GRCm39) nonsense probably null
V7732:Fanca UTSW 8 124,031,020 (GRCm39) splice site probably benign
X0025:Fanca UTSW 8 124,003,287 (GRCm39) intron probably benign
X0062:Fanca UTSW 8 124,031,591 (GRCm39) missense possibly damaging 0.95
Z1177:Fanca UTSW 8 124,039,368 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGTCTTGACTTCGGAGAC -3'
(R):5'- TCTGGAAAGTATTGTACAGGGC -3'

Sequencing Primer
(F):5'- GTCTTGACTTCGGAGACACACAC -3'
(R):5'- TATTGTACAGGGCAAGGACACC -3'
Posted On 2014-09-17