Incidental Mutation 'R2060:Dync2h1'
ID 228620
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Name dynein cytoplasmic 2 heavy chain 1
Synonyms DHC1b, b2b414Clo, Dnchc2, m407Asp, m152Asp, D030010H02Rik, 4432416O06Rik, DHC2, D330044F14Rik
MMRRC Submission 040065-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2060 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 6928550-7177619 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 7162802 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 596 (I596L)
Ref Sequence ENSEMBL: ENSMUSP00000120322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000139115] [ENSMUST00000140466] [ENSMUST00000147193]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000048417
AA Change: I596L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193
AA Change: I596L

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000139115
AA Change: I596L

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120322
Gene: ENSMUSG00000047193
AA Change: I596L

DomainStartEndE-ValueType
Pfam:DHC_N1 188 676 3.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140466
AA Change: I596L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193
AA Change: I596L

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147056
Predicted Effect probably benign
Transcript: ENSMUST00000147193
AA Change: I596L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193
AA Change: I596L

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 119,826,741 (GRCm39) W462* probably null Het
Aftph A T 11: 20,642,571 (GRCm39) Y821N probably damaging Het
Ahnak A T 19: 8,985,405 (GRCm39) M2230L probably benign Het
Arfgap1 T C 2: 180,614,575 (GRCm39) F144L probably benign Het
Arid4b C T 13: 14,370,037 (GRCm39) R1178C probably damaging Het
Asb8 A T 15: 98,039,254 (GRCm39) C49S possibly damaging Het
Baz1b A G 5: 135,233,968 (GRCm39) N165S probably damaging Het
Bod1l A T 5: 41,966,085 (GRCm39) I2660N possibly damaging Het
C2cd3 T C 7: 100,104,155 (GRCm39) I825T probably damaging Het
C4b A G 17: 34,955,075 (GRCm39) W804R probably damaging Het
Cadm3 A T 1: 173,171,969 (GRCm39) D201E probably damaging Het
Cdh17 T C 4: 11,803,982 (GRCm39) F552L probably benign Het
Cdh20 G C 1: 109,976,607 (GRCm39) A91P probably damaging Het
Cela1 A G 15: 100,573,203 (GRCm39) probably null Het
Clk3 T C 9: 57,658,400 (GRCm39) Y582C probably damaging Het
Cma1 C T 14: 56,181,155 (GRCm39) probably null Het
Ctcfl A G 2: 172,960,299 (GRCm39) S95P probably benign Het
Cylc1 C A X: 110,166,892 (GRCm39) T391K unknown Het
Cyp3a11 T A 5: 145,791,891 (GRCm39) I501L probably benign Het
Cyp3a59 T A 5: 146,041,524 (GRCm39) L356Q probably damaging Het
Dcdc2a A C 13: 25,291,693 (GRCm39) D226A possibly damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dlec1 A C 9: 118,941,154 (GRCm39) T235P probably damaging Het
Dnaaf1 G A 8: 120,317,341 (GRCm39) R290Q probably benign Het
Dnaaf5 C T 5: 139,163,758 (GRCm39) R377W probably damaging Het
Dpep1 T A 8: 123,927,130 (GRCm39) V293E probably damaging Het
Drosha T A 15: 12,924,245 (GRCm39) V1209E possibly damaging Het
Edem1 T A 6: 108,831,248 (GRCm39) Y570N probably damaging Het
Edrf1 G T 7: 133,258,858 (GRCm39) E9* probably null Het
Enpep T A 3: 129,074,172 (GRCm39) N792Y probably benign Het
Enpp2 A T 15: 54,739,110 (GRCm39) M391K probably damaging Het
Fanca A C 8: 124,001,220 (GRCm39) V1105G probably damaging Het
Fbxo22 T A 9: 55,125,667 (GRCm39) L74I probably damaging Het
Fchsd2 T A 7: 100,926,624 (GRCm39) F571L probably benign Het
Fhad1 T C 4: 141,626,560 (GRCm39) D1345G probably benign Het
G2e3 T C 12: 51,419,389 (GRCm39) F702L probably damaging Het
Glce A T 9: 61,968,228 (GRCm39) S308T possibly damaging Het
Glt1d1 A G 5: 127,734,183 (GRCm39) D119G probably benign Het
Gpr137c T C 14: 45,481,616 (GRCm39) I144T probably damaging Het
Gprin3 A G 6: 59,331,504 (GRCm39) C268R possibly damaging Het
Hadha G A 5: 30,333,834 (GRCm39) T395M probably benign Het
Hdhd2 T G 18: 77,052,738 (GRCm39) probably null Het
Homer2 C T 7: 81,268,451 (GRCm39) E70K probably benign Het
Hp1bp3 T A 4: 137,967,983 (GRCm39) D397E probably damaging Het
Hrh3 T C 2: 179,743,043 (GRCm39) N195S possibly damaging Het
Hyou1 T C 9: 44,292,849 (GRCm39) V153A probably benign Het
Igf2r A T 17: 12,920,206 (GRCm39) S1378T possibly damaging Het
Ints4 G A 7: 97,150,970 (GRCm39) R279H possibly damaging Het
Itga10 A T 3: 96,562,314 (GRCm39) R699* probably null Het
Itpkb A G 1: 180,249,423 (GRCm39) T933A probably benign Het
Itsn2 T G 12: 4,677,879 (GRCm39) F79V probably damaging Het
Jak3 C A 8: 72,133,358 (GRCm39) C350* probably null Het
Jak3 A T 8: 72,136,059 (GRCm39) K620* probably null Het
Kcnq5 T C 1: 21,531,821 (GRCm39) S421G probably benign Het
Kdm2b A T 5: 123,021,428 (GRCm39) M50K probably damaging Het
Klk1b1 A G 7: 43,620,047 (GRCm39) D170G possibly damaging Het
Lama3 A T 18: 12,661,783 (GRCm39) T2160S probably benign Het
Lman1 A T 18: 66,131,423 (GRCm39) probably benign Het
Lmtk3 G A 7: 45,450,335 (GRCm39) probably null Het
Ltb A G 17: 35,414,739 (GRCm39) R180G probably damaging Het
Ltbp4 C T 7: 27,008,378 (GRCm39) R1310Q probably damaging Het
Macf1 T A 4: 123,393,712 (GRCm39) probably null Het
Mast4 G T 13: 102,875,354 (GRCm39) P1146Q probably damaging Het
Micall2 C T 5: 139,697,317 (GRCm39) S678N probably damaging Het
Mon2 A T 10: 122,831,681 (GRCm39) I1675N probably damaging Het
Mug2 A G 6: 122,056,571 (GRCm39) N1172S probably benign Het
Naa30 C G 14: 49,410,556 (GRCm39) S161R possibly damaging Het
Ncaph T C 2: 126,966,795 (GRCm39) N220D probably damaging Het
Nell1 T C 7: 50,210,578 (GRCm39) V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 (GRCm38) N142S possibly damaging Het
Nin T A 12: 70,089,192 (GRCm39) T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 (GRCm38) noncoding transcript Het
Nrg1 T G 8: 32,408,043 (GRCm39) E63D probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or14j7 A G 17: 38,234,771 (GRCm39) T105A probably benign Het
Or5d39 T C 2: 87,979,487 (GRCm39) Y292C probably damaging Het
Or5g29 G A 2: 85,421,627 (GRCm39) V248I possibly damaging Het
Or5p53 C T 7: 107,532,868 (GRCm39) T47M probably benign Het
Or6ae1 T A 7: 139,742,737 (GRCm39) E42V probably damaging Het
Or7d11 A T 9: 19,965,892 (GRCm39) I289N probably damaging Het
Or7g27 A G 9: 19,250,352 (GRCm39) I199V probably benign Het
Or7g32 T A 9: 19,408,533 (GRCm39) V163E possibly damaging Het
Orc5 C T 5: 22,721,701 (GRCm39) probably null Het
Pard3 G A 8: 128,125,085 (GRCm39) R691Q probably benign Het
Pofut1 T A 2: 153,085,580 (GRCm39) D54E probably benign Het
Prl2c5 T A 13: 13,365,238 (GRCm39) V128E probably damaging Het
Ptk7 T C 17: 46,877,164 (GRCm39) M965V possibly damaging Het
Pum2 C T 12: 8,778,726 (GRCm39) R459* probably null Het
Pzp A T 6: 128,460,673 (GRCm39) N1494K probably benign Het
Rad21l A G 2: 151,487,349 (GRCm39) V545A probably benign Het
Rps6kc1 A T 1: 190,542,305 (GRCm39) M352K possibly damaging Het
Rpusd2 G A 2: 118,867,696 (GRCm39) probably null Het
Rsph14 A T 10: 74,865,603 (GRCm39) D78E probably damaging Het
Rtl9 A T X: 141,885,026 (GRCm39) M813L possibly damaging Het
Rtp4 A T 16: 23,431,690 (GRCm39) H74L probably damaging Het
Rusc1 G A 3: 88,995,155 (GRCm39) T725I possibly damaging Het
Rusf1 A G 7: 127,887,503 (GRCm39) L176P probably damaging Het
Ryr2 C T 13: 11,610,622 (GRCm39) C4068Y probably damaging Het
Ryr3 A G 2: 112,784,709 (GRCm39) V224A possibly damaging Het
Shprh A T 10: 11,027,864 (GRCm39) N157I probably benign Het
Siglece A G 7: 43,307,210 (GRCm39) I67T probably benign Het
Slc9b2 A T 3: 135,032,027 (GRCm39) T296S probably damaging Het
Sorbs2 A G 8: 46,228,666 (GRCm39) K276E probably damaging Het
Synj2 A G 17: 6,087,755 (GRCm39) T1269A probably benign Het
Taar7b T C 10: 23,876,573 (GRCm39) I246T possibly damaging Het
Taldo1 A G 7: 140,976,067 (GRCm39) Y113C probably damaging Het
Tarbp1 A T 8: 127,174,333 (GRCm39) probably null Het
Tars1 C T 15: 11,394,459 (GRCm39) M59I probably benign Het
Tas2r130 G A 6: 131,607,780 (GRCm39) T5I probably benign Het
Tex48 T C 4: 63,525,652 (GRCm39) E77G probably damaging Het
Tmco5 A G 2: 116,722,736 (GRCm39) R286G probably damaging Het
Trdmt1 A T 2: 13,524,725 (GRCm39) H243Q probably benign Het
Ttn T A 2: 76,564,638 (GRCm39) R26754* probably null Het
Ttn G A 2: 76,727,924 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,791,358 (GRCm39) L244R probably damaging Het
Ubxn1 C T 19: 8,850,930 (GRCm39) R115* probably null Het
Umod T G 7: 119,075,938 (GRCm39) N276T probably damaging Het
Unc13c A T 9: 73,572,938 (GRCm39) L1528Q probably damaging Het
Unc80 T A 1: 66,679,754 (GRCm39) H2108Q possibly damaging Het
Utp20 A C 10: 88,610,657 (GRCm39) D1442E probably damaging Het
Utp4 A G 8: 107,625,153 (GRCm39) Q144R probably benign Het
Vmn2r17 T A 5: 109,575,075 (GRCm39) N127K probably benign Het
Vmn2r75 T A 7: 85,814,372 (GRCm39) T374S probably benign Het
Washc5 A G 15: 59,222,257 (GRCm39) F523L probably damaging Het
Wdr3 A T 3: 100,067,213 (GRCm39) probably null Het
Wdr89 T C 12: 75,679,762 (GRCm39) Y164C probably damaging Het
Xpo5 T C 17: 46,536,017 (GRCm39) S550P probably damaging Het
Zfp69 T C 4: 120,788,029 (GRCm39) T429A probably damaging Het
Zfpm1 G T 8: 123,063,331 (GRCm39) G797C probably benign Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7,158,839 (GRCm39) missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7,155,072 (GRCm39) splice site probably benign
IGL00499:Dync2h1 APN 9 7,168,700 (GRCm39) missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7,035,728 (GRCm39) splice site probably benign
IGL00660:Dync2h1 APN 9 7,075,797 (GRCm39) missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7,174,881 (GRCm39) splice site probably benign
IGL01025:Dync2h1 APN 9 7,162,789 (GRCm39) missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7,145,611 (GRCm39) missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7,176,771 (GRCm39) missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7,116,588 (GRCm39) missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7,102,493 (GRCm39) missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7,071,111 (GRCm39) missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7,071,922 (GRCm39) missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7,140,897 (GRCm39) critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7,118,884 (GRCm39) nonsense probably null
IGL01681:Dync2h1 APN 9 7,142,196 (GRCm39) splice site probably null
IGL01685:Dync2h1 APN 9 7,142,297 (GRCm39) missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7,081,077 (GRCm39) missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7,114,922 (GRCm39) missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7,118,822 (GRCm39) unclassified probably benign
IGL01813:Dync2h1 APN 9 7,122,799 (GRCm39) missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7,114,973 (GRCm39) missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7,011,207 (GRCm39) missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7,075,892 (GRCm39) missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7,134,349 (GRCm39) missense probably benign
IGL02140:Dync2h1 APN 9 7,147,791 (GRCm39) missense probably benign
IGL02175:Dync2h1 APN 9 7,111,548 (GRCm39) missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7,125,912 (GRCm39) missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7,122,678 (GRCm39) missense probably benign
IGL02342:Dync2h1 APN 9 7,142,246 (GRCm39) missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7,158,926 (GRCm39) missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7,117,422 (GRCm39) missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7,035,700 (GRCm39) missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6,955,901 (GRCm39) splice site probably benign
IGL02955:Dync2h1 APN 9 7,142,864 (GRCm39) missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7,137,074 (GRCm39) missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6,935,279 (GRCm39) missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7,076,235 (GRCm39) missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7,125,918 (GRCm39) missense probably benign
IGL03233:Dync2h1 APN 9 7,101,525 (GRCm39) missense possibly damaging 0.90
deinonychus UTSW 9 7,159,478 (GRCm39) splice site probably null
R0016:Dync2h1 UTSW 9 7,144,346 (GRCm39) splice site probably benign
R0016:Dync2h1 UTSW 9 7,144,346 (GRCm39) splice site probably benign
R0043:Dync2h1 UTSW 9 7,005,574 (GRCm39) missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7,111,487 (GRCm39) missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7,111,487 (GRCm39) missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7,001,327 (GRCm39) splice site probably benign
R0277:Dync2h1 UTSW 9 7,129,046 (GRCm39) missense probably benign
R0360:Dync2h1 UTSW 9 7,113,182 (GRCm39) missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7,005,487 (GRCm39) splice site probably null
R0389:Dync2h1 UTSW 9 7,167,244 (GRCm39) splice site probably null
R0443:Dync2h1 UTSW 9 7,167,244 (GRCm39) splice site probably null
R0496:Dync2h1 UTSW 9 7,155,180 (GRCm39) missense probably benign 0.42
R0506:Dync2h1 UTSW 9 7,113,153 (GRCm39) missense probably benign 0.05
R0511:Dync2h1 UTSW 9 7,122,692 (GRCm39) missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7,051,480 (GRCm39) missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7,120,954 (GRCm39) splice site probably null
R0564:Dync2h1 UTSW 9 7,139,432 (GRCm39) missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7,051,480 (GRCm39) missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7,103,680 (GRCm39) missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7,015,497 (GRCm39) missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7,116,642 (GRCm39) critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7,077,979 (GRCm39) missense probably benign 0.07
R0894:Dync2h1 UTSW 9 7,041,734 (GRCm39) splice site probably benign
R0938:Dync2h1 UTSW 9 7,002,658 (GRCm39) missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7,147,731 (GRCm39) missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7,005,488 (GRCm39) critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7,101,193 (GRCm39) splice site probably benign
R1243:Dync2h1 UTSW 9 7,120,882 (GRCm39) missense probably benign
R1295:Dync2h1 UTSW 9 7,075,752 (GRCm39) splice site probably benign
R1304:Dync2h1 UTSW 9 7,102,318 (GRCm39) missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7,125,816 (GRCm39) missense probably benign
R1513:Dync2h1 UTSW 9 7,103,663 (GRCm39) missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7,140,911 (GRCm39) missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7,157,553 (GRCm39) missense probably null 0.02
R1570:Dync2h1 UTSW 9 7,176,926 (GRCm39) missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6,993,942 (GRCm39) missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7,131,891 (GRCm39) missense probably benign
R1766:Dync2h1 UTSW 9 7,015,526 (GRCm39) critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7,128,256 (GRCm39) missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7,081,084 (GRCm39) missense probably damaging 1.00
R1848:Dync2h1 UTSW 9 7,049,166 (GRCm39) missense probably benign 0.01
R1850:Dync2h1 UTSW 9 7,001,448 (GRCm39) missense probably benign 0.00
R1935:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1939:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1940:Dync2h1 UTSW 9 7,139,159 (GRCm39) critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7,001,377 (GRCm39) missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7,129,045 (GRCm39) missense probably benign
R2012:Dync2h1 UTSW 9 7,169,589 (GRCm39) missense probably benign 0.00
R2020:Dync2h1 UTSW 9 7,162,925 (GRCm39) missense probably benign 0.25
R2020:Dync2h1 UTSW 9 7,122,772 (GRCm39) missense probably damaging 0.99
R2024:Dync2h1 UTSW 9 7,129,062 (GRCm39) missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6,967,226 (GRCm39) missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7,160,171 (GRCm39) missense probably damaging 1.00
R2094:Dync2h1 UTSW 9 7,148,735 (GRCm39) missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7,175,289 (GRCm39) missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7,011,253 (GRCm39) missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7,122,772 (GRCm39) missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7,124,797 (GRCm39) missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7,037,828 (GRCm39) splice site probably null
R2255:Dync2h1 UTSW 9 6,955,905 (GRCm39) critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7,081,053 (GRCm39) missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7,122,618 (GRCm39) missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7,144,246 (GRCm39) missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7,102,329 (GRCm39) missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7,049,114 (GRCm39) missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7,011,236 (GRCm39) missense probably benign
R3719:Dync2h1 UTSW 9 7,006,882 (GRCm39) splice site probably benign
R3723:Dync2h1 UTSW 9 7,041,658 (GRCm39) missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7,101,525 (GRCm39) missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6,935,293 (GRCm39) missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7,001,482 (GRCm39) missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7,124,825 (GRCm39) missense probably benign
R3950:Dync2h1 UTSW 9 7,112,061 (GRCm39) nonsense probably null
R4004:Dync2h1 UTSW 9 7,117,404 (GRCm39) missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7,131,881 (GRCm39) missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7,134,360 (GRCm39) missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7,077,880 (GRCm39) missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6,983,477 (GRCm39) missense probably benign 0.02
R4512:Dync2h1 UTSW 9 7,085,009 (GRCm39) nonsense probably null
R4596:Dync2h1 UTSW 9 6,992,595 (GRCm39) missense probably benign
R4604:Dync2h1 UTSW 9 7,140,995 (GRCm39) missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7,011,290 (GRCm39) missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7,051,411 (GRCm39) missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7,169,640 (GRCm39) missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7,118,932 (GRCm39) missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7,142,648 (GRCm39) critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7,006,862 (GRCm39) missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7,139,422 (GRCm39) missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7,134,364 (GRCm39) missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7,147,717 (GRCm39) missense probably benign
R4899:Dync2h1 UTSW 9 7,131,921 (GRCm39) nonsense probably null
R4971:Dync2h1 UTSW 9 7,131,949 (GRCm39) missense probably benign
R5040:Dync2h1 UTSW 9 6,992,625 (GRCm39) missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7,085,007 (GRCm39) missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7,116,540 (GRCm39) missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7,155,099 (GRCm39) missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7,129,727 (GRCm39) missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7,176,962 (GRCm39) unclassified probably benign
R5384:Dync2h1 UTSW 9 7,016,791 (GRCm39) missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7,016,791 (GRCm39) missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7,120,899 (GRCm39) nonsense probably null
R5402:Dync2h1 UTSW 9 7,114,949 (GRCm39) missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7,144,217 (GRCm39) missense probably benign
R5538:Dync2h1 UTSW 9 7,168,630 (GRCm39) intron probably benign
R5551:Dync2h1 UTSW 9 7,031,718 (GRCm39) missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7,118,885 (GRCm39) missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7,120,909 (GRCm39) missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7,116,638 (GRCm39) missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7,148,659 (GRCm39) missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7,169,689 (GRCm39) missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7,169,528 (GRCm39) missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7,165,762 (GRCm39) missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6,996,905 (GRCm39) missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7,011,290 (GRCm39) missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7,148,717 (GRCm39) missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7,102,309 (GRCm39) critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7,037,801 (GRCm39) missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7,117,466 (GRCm39) nonsense probably null
R5982:Dync2h1 UTSW 9 6,955,986 (GRCm39) missense probably benign 0.00
R6029:Dync2h1 UTSW 9 7,157,646 (GRCm39) missense probably benign
R6125:Dync2h1 UTSW 9 7,168,706 (GRCm39) missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7,165,677 (GRCm39) missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7,135,078 (GRCm39) missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7,084,986 (GRCm39) missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7,165,717 (GRCm39) missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7,165,703 (GRCm39) missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7,168,331 (GRCm39) missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7,159,478 (GRCm39) splice site probably null
R6554:Dync2h1 UTSW 9 7,037,699 (GRCm39) missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7,139,501 (GRCm39) missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7,120,819 (GRCm39) missense probably benign 0.27
R6807:Dync2h1 UTSW 9 7,041,718 (GRCm39) missense probably benign 0.10
R6848:Dync2h1 UTSW 9 7,159,632 (GRCm39) missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7,131,855 (GRCm39) missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7,102,549 (GRCm39) missense probably benign
R6997:Dync2h1 UTSW 9 7,168,743 (GRCm39) missense probably null 0.00
R7084:Dync2h1 UTSW 9 7,113,214 (GRCm39) missense possibly damaging 0.72
R7113:Dync2h1 UTSW 9 7,075,788 (GRCm39) missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7,075,786 (GRCm39) missense probably damaging 1.00
R7165:Dync2h1 UTSW 9 7,050,479 (GRCm39) missense probably benign
R7196:Dync2h1 UTSW 9 7,147,715 (GRCm39) nonsense probably null
R7208:Dync2h1 UTSW 9 7,141,059 (GRCm39) missense probably damaging 1.00
R7225:Dync2h1 UTSW 9 7,142,756 (GRCm39) missense probably benign
R7237:Dync2h1 UTSW 9 6,993,966 (GRCm39) missense probably benign 0.00
R7243:Dync2h1 UTSW 9 7,102,405 (GRCm39) missense possibly damaging 0.64
R7291:Dync2h1 UTSW 9 6,929,590 (GRCm39) missense possibly damaging 0.69
R7293:Dync2h1 UTSW 9 7,001,454 (GRCm39) missense possibly damaging 0.88
R7329:Dync2h1 UTSW 9 7,011,247 (GRCm39) missense probably benign
R7351:Dync2h1 UTSW 9 7,167,145 (GRCm39) missense probably damaging 1.00
R7358:Dync2h1 UTSW 9 7,159,479 (GRCm39) critical splice donor site probably null
R7387:Dync2h1 UTSW 9 7,157,932 (GRCm39) missense possibly damaging 0.68
R7446:Dync2h1 UTSW 9 7,041,720 (GRCm39) missense probably benign 0.03
R7487:Dync2h1 UTSW 9 7,132,041 (GRCm39) missense probably benign 0.26
R7488:Dync2h1 UTSW 9 7,124,855 (GRCm39) missense probably benign 0.03
R7496:Dync2h1 UTSW 9 7,135,015 (GRCm39) splice site probably null
R7501:Dync2h1 UTSW 9 7,175,336 (GRCm39) missense possibly damaging 0.82
R7571:Dync2h1 UTSW 9 7,002,623 (GRCm39) missense probably damaging 1.00
R7627:Dync2h1 UTSW 9 7,101,111 (GRCm39) missense probably benign 0.00
R7639:Dync2h1 UTSW 9 7,141,254 (GRCm39) missense probably damaging 0.97
R7653:Dync2h1 UTSW 9 7,117,570 (GRCm39) missense probably benign
R7654:Dync2h1 UTSW 9 7,122,664 (GRCm39) missense probably damaging 1.00
R7742:Dync2h1 UTSW 9 7,076,232 (GRCm39) missense probably benign 0.00
R7755:Dync2h1 UTSW 9 7,015,490 (GRCm39) missense probably benign 0.00
R7762:Dync2h1 UTSW 9 7,129,719 (GRCm39) missense probably benign 0.01
R7790:Dync2h1 UTSW 9 7,114,914 (GRCm39) missense probably damaging 0.96
R7834:Dync2h1 UTSW 9 7,118,953 (GRCm39) missense probably benign 0.04
R7883:Dync2h1 UTSW 9 7,005,566 (GRCm39) missense possibly damaging 0.80
R7952:Dync2h1 UTSW 9 7,129,802 (GRCm39) missense possibly damaging 0.63
R8111:Dync2h1 UTSW 9 7,148,688 (GRCm39) missense probably benign 0.03
R8157:Dync2h1 UTSW 9 7,001,473 (GRCm39) missense possibly damaging 0.47
R8166:Dync2h1 UTSW 9 7,129,089 (GRCm39) nonsense probably null
R8236:Dync2h1 UTSW 9 7,080,363 (GRCm39) intron probably benign
R8326:Dync2h1 UTSW 9 7,147,771 (GRCm39) missense probably benign
R8335:Dync2h1 UTSW 9 7,084,941 (GRCm39) missense probably benign 0.28
R8347:Dync2h1 UTSW 9 7,116,578 (GRCm39) missense possibly damaging 0.81
R8372:Dync2h1 UTSW 9 7,111,514 (GRCm39) missense possibly damaging 0.90
R8421:Dync2h1 UTSW 9 7,102,477 (GRCm39) missense probably damaging 1.00
R8518:Dync2h1 UTSW 9 7,051,452 (GRCm39) missense probably benign 0.04
R8556:Dync2h1 UTSW 9 7,113,198 (GRCm39) missense probably benign 0.32
R8690:Dync2h1 UTSW 9 7,075,824 (GRCm39) missense probably damaging 1.00
R8713:Dync2h1 UTSW 9 7,141,008 (GRCm39) nonsense probably null
R8719:Dync2h1 UTSW 9 7,041,641 (GRCm39) missense probably benign 0.05
R8732:Dync2h1 UTSW 9 7,168,326 (GRCm39) missense probably damaging 1.00
R8744:Dync2h1 UTSW 9 7,011,220 (GRCm39) nonsense probably null
R8749:Dync2h1 UTSW 9 7,035,063 (GRCm39) missense probably benign 0.32
R8795:Dync2h1 UTSW 9 7,137,087 (GRCm39) missense probably benign 0.00
R8853:Dync2h1 UTSW 9 7,117,645 (GRCm39) missense possibly damaging 0.94
R8923:Dync2h1 UTSW 9 7,168,515 (GRCm39) missense probably benign
R8969:Dync2h1 UTSW 9 7,130,723 (GRCm39) missense probably damaging 1.00
R8988:Dync2h1 UTSW 9 7,037,727 (GRCm39) missense probably benign 0.00
R8997:Dync2h1 UTSW 9 7,129,003 (GRCm39) missense probably benign
R9025:Dync2h1 UTSW 9 7,139,462 (GRCm39) nonsense probably null
R9036:Dync2h1 UTSW 9 7,051,495 (GRCm39) missense probably damaging 1.00
R9055:Dync2h1 UTSW 9 6,996,641 (GRCm39) intron probably benign
R9165:Dync2h1 UTSW 9 7,114,883 (GRCm39) missense probably damaging 0.99
R9172:Dync2h1 UTSW 9 7,031,771 (GRCm39) missense probably damaging 1.00
R9286:Dync2h1 UTSW 9 6,941,668 (GRCm39) missense probably benign 0.01
R9312:Dync2h1 UTSW 9 7,050,413 (GRCm39) missense probably damaging 1.00
R9335:Dync2h1 UTSW 9 7,112,149 (GRCm39) missense possibly damaging 0.88
R9344:Dync2h1 UTSW 9 7,148,659 (GRCm39) missense probably benign 0.01
R9351:Dync2h1 UTSW 9 7,176,911 (GRCm39) missense probably damaging 0.98
R9367:Dync2h1 UTSW 9 7,125,730 (GRCm39) critical splice donor site probably null
R9613:Dync2h1 UTSW 9 7,075,769 (GRCm39) missense probably damaging 0.99
R9650:Dync2h1 UTSW 9 7,174,849 (GRCm39) missense possibly damaging 0.83
R9726:Dync2h1 UTSW 9 7,077,999 (GRCm39) missense possibly damaging 0.94
R9731:Dync2h1 UTSW 9 7,141,166 (GRCm39) missense probably benign
X0009:Dync2h1 UTSW 9 7,117,576 (GRCm39) missense possibly damaging 0.81
Z1176:Dync2h1 UTSW 9 7,168,730 (GRCm39) frame shift probably null
Z1176:Dync2h1 UTSW 9 7,142,361 (GRCm39) missense probably damaging 0.99
Z1177:Dync2h1 UTSW 9 7,102,427 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCCAGTGCTATGCTTG -3'
(R):5'- GTGTAGCTTAAAAGATTCCTCTCTC -3'

Sequencing Primer
(F):5'- CCAGTGCTATGCTTGTCTGC -3'
(R):5'- AGCTTAAAAGATTCCTCTCTCCTCTC -3'
Posted On 2014-09-17