Incidental Mutation 'R2060:Unc13c'
ID 228628
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Name unc-13 homolog C
Synonyms D9Ertd414e, 1500037O19Rik, Munc13-3, Unc13h3
MMRRC Submission 040065-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2060 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 73386704-73876248 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 73572938 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 1528 (L1528Q)
Ref Sequence ENSEMBL: ENSMUSP00000139027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
AlphaFold Q8K0T7
Predicted Effect probably damaging
Transcript: ENSMUST00000075245
AA Change: L1528Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: L1528Q

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184666
AA Change: L1528Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: L1528Q

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 119,826,741 (GRCm39) W462* probably null Het
Aftph A T 11: 20,642,571 (GRCm39) Y821N probably damaging Het
Ahnak A T 19: 8,985,405 (GRCm39) M2230L probably benign Het
Arfgap1 T C 2: 180,614,575 (GRCm39) F144L probably benign Het
Arid4b C T 13: 14,370,037 (GRCm39) R1178C probably damaging Het
Asb8 A T 15: 98,039,254 (GRCm39) C49S possibly damaging Het
Baz1b A G 5: 135,233,968 (GRCm39) N165S probably damaging Het
Bod1l A T 5: 41,966,085 (GRCm39) I2660N possibly damaging Het
C2cd3 T C 7: 100,104,155 (GRCm39) I825T probably damaging Het
C4b A G 17: 34,955,075 (GRCm39) W804R probably damaging Het
Cadm3 A T 1: 173,171,969 (GRCm39) D201E probably damaging Het
Cdh17 T C 4: 11,803,982 (GRCm39) F552L probably benign Het
Cdh20 G C 1: 109,976,607 (GRCm39) A91P probably damaging Het
Cela1 A G 15: 100,573,203 (GRCm39) probably null Het
Clk3 T C 9: 57,658,400 (GRCm39) Y582C probably damaging Het
Cma1 C T 14: 56,181,155 (GRCm39) probably null Het
Ctcfl A G 2: 172,960,299 (GRCm39) S95P probably benign Het
Cylc1 C A X: 110,166,892 (GRCm39) T391K unknown Het
Cyp3a11 T A 5: 145,791,891 (GRCm39) I501L probably benign Het
Cyp3a59 T A 5: 146,041,524 (GRCm39) L356Q probably damaging Het
Dcdc2a A C 13: 25,291,693 (GRCm39) D226A possibly damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dlec1 A C 9: 118,941,154 (GRCm39) T235P probably damaging Het
Dnaaf1 G A 8: 120,317,341 (GRCm39) R290Q probably benign Het
Dnaaf5 C T 5: 139,163,758 (GRCm39) R377W probably damaging Het
Dpep1 T A 8: 123,927,130 (GRCm39) V293E probably damaging Het
Drosha T A 15: 12,924,245 (GRCm39) V1209E possibly damaging Het
Dync2h1 T G 9: 7,162,802 (GRCm39) I596L possibly damaging Het
Edem1 T A 6: 108,831,248 (GRCm39) Y570N probably damaging Het
Edrf1 G T 7: 133,258,858 (GRCm39) E9* probably null Het
Enpep T A 3: 129,074,172 (GRCm39) N792Y probably benign Het
Enpp2 A T 15: 54,739,110 (GRCm39) M391K probably damaging Het
Fanca A C 8: 124,001,220 (GRCm39) V1105G probably damaging Het
Fbxo22 T A 9: 55,125,667 (GRCm39) L74I probably damaging Het
Fchsd2 T A 7: 100,926,624 (GRCm39) F571L probably benign Het
Fhad1 T C 4: 141,626,560 (GRCm39) D1345G probably benign Het
G2e3 T C 12: 51,419,389 (GRCm39) F702L probably damaging Het
Glce A T 9: 61,968,228 (GRCm39) S308T possibly damaging Het
Glt1d1 A G 5: 127,734,183 (GRCm39) D119G probably benign Het
Gpr137c T C 14: 45,481,616 (GRCm39) I144T probably damaging Het
Gprin3 A G 6: 59,331,504 (GRCm39) C268R possibly damaging Het
Hadha G A 5: 30,333,834 (GRCm39) T395M probably benign Het
Hdhd2 T G 18: 77,052,738 (GRCm39) probably null Het
Homer2 C T 7: 81,268,451 (GRCm39) E70K probably benign Het
Hp1bp3 T A 4: 137,967,983 (GRCm39) D397E probably damaging Het
Hrh3 T C 2: 179,743,043 (GRCm39) N195S possibly damaging Het
Hyou1 T C 9: 44,292,849 (GRCm39) V153A probably benign Het
Igf2r A T 17: 12,920,206 (GRCm39) S1378T possibly damaging Het
Ints4 G A 7: 97,150,970 (GRCm39) R279H possibly damaging Het
Itga10 A T 3: 96,562,314 (GRCm39) R699* probably null Het
Itpkb A G 1: 180,249,423 (GRCm39) T933A probably benign Het
Itsn2 T G 12: 4,677,879 (GRCm39) F79V probably damaging Het
Jak3 C A 8: 72,133,358 (GRCm39) C350* probably null Het
Jak3 A T 8: 72,136,059 (GRCm39) K620* probably null Het
Kcnq5 T C 1: 21,531,821 (GRCm39) S421G probably benign Het
Kdm2b A T 5: 123,021,428 (GRCm39) M50K probably damaging Het
Klk1b1 A G 7: 43,620,047 (GRCm39) D170G possibly damaging Het
Lama3 A T 18: 12,661,783 (GRCm39) T2160S probably benign Het
Lman1 A T 18: 66,131,423 (GRCm39) probably benign Het
Lmtk3 G A 7: 45,450,335 (GRCm39) probably null Het
Ltb A G 17: 35,414,739 (GRCm39) R180G probably damaging Het
Ltbp4 C T 7: 27,008,378 (GRCm39) R1310Q probably damaging Het
Macf1 T A 4: 123,393,712 (GRCm39) probably null Het
Mast4 G T 13: 102,875,354 (GRCm39) P1146Q probably damaging Het
Micall2 C T 5: 139,697,317 (GRCm39) S678N probably damaging Het
Mon2 A T 10: 122,831,681 (GRCm39) I1675N probably damaging Het
Mug2 A G 6: 122,056,571 (GRCm39) N1172S probably benign Het
Naa30 C G 14: 49,410,556 (GRCm39) S161R possibly damaging Het
Ncaph T C 2: 126,966,795 (GRCm39) N220D probably damaging Het
Nell1 T C 7: 50,210,578 (GRCm39) V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 (GRCm38) N142S possibly damaging Het
Nin T A 12: 70,089,192 (GRCm39) T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 (GRCm38) noncoding transcript Het
Nrg1 T G 8: 32,408,043 (GRCm39) E63D probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or14j7 A G 17: 38,234,771 (GRCm39) T105A probably benign Het
Or5d39 T C 2: 87,979,487 (GRCm39) Y292C probably damaging Het
Or5g29 G A 2: 85,421,627 (GRCm39) V248I possibly damaging Het
Or5p53 C T 7: 107,532,868 (GRCm39) T47M probably benign Het
Or6ae1 T A 7: 139,742,737 (GRCm39) E42V probably damaging Het
Or7d11 A T 9: 19,965,892 (GRCm39) I289N probably damaging Het
Or7g27 A G 9: 19,250,352 (GRCm39) I199V probably benign Het
Or7g32 T A 9: 19,408,533 (GRCm39) V163E possibly damaging Het
Orc5 C T 5: 22,721,701 (GRCm39) probably null Het
Pard3 G A 8: 128,125,085 (GRCm39) R691Q probably benign Het
Pofut1 T A 2: 153,085,580 (GRCm39) D54E probably benign Het
Prl2c5 T A 13: 13,365,238 (GRCm39) V128E probably damaging Het
Ptk7 T C 17: 46,877,164 (GRCm39) M965V possibly damaging Het
Pum2 C T 12: 8,778,726 (GRCm39) R459* probably null Het
Pzp A T 6: 128,460,673 (GRCm39) N1494K probably benign Het
Rad21l A G 2: 151,487,349 (GRCm39) V545A probably benign Het
Rps6kc1 A T 1: 190,542,305 (GRCm39) M352K possibly damaging Het
Rpusd2 G A 2: 118,867,696 (GRCm39) probably null Het
Rsph14 A T 10: 74,865,603 (GRCm39) D78E probably damaging Het
Rtl9 A T X: 141,885,026 (GRCm39) M813L possibly damaging Het
Rtp4 A T 16: 23,431,690 (GRCm39) H74L probably damaging Het
Rusc1 G A 3: 88,995,155 (GRCm39) T725I possibly damaging Het
Rusf1 A G 7: 127,887,503 (GRCm39) L176P probably damaging Het
Ryr2 C T 13: 11,610,622 (GRCm39) C4068Y probably damaging Het
Ryr3 A G 2: 112,784,709 (GRCm39) V224A possibly damaging Het
Shprh A T 10: 11,027,864 (GRCm39) N157I probably benign Het
Siglece A G 7: 43,307,210 (GRCm39) I67T probably benign Het
Slc9b2 A T 3: 135,032,027 (GRCm39) T296S probably damaging Het
Sorbs2 A G 8: 46,228,666 (GRCm39) K276E probably damaging Het
Synj2 A G 17: 6,087,755 (GRCm39) T1269A probably benign Het
Taar7b T C 10: 23,876,573 (GRCm39) I246T possibly damaging Het
Taldo1 A G 7: 140,976,067 (GRCm39) Y113C probably damaging Het
Tarbp1 A T 8: 127,174,333 (GRCm39) probably null Het
Tars1 C T 15: 11,394,459 (GRCm39) M59I probably benign Het
Tas2r130 G A 6: 131,607,780 (GRCm39) T5I probably benign Het
Tex48 T C 4: 63,525,652 (GRCm39) E77G probably damaging Het
Tmco5 A G 2: 116,722,736 (GRCm39) R286G probably damaging Het
Trdmt1 A T 2: 13,524,725 (GRCm39) H243Q probably benign Het
Ttn T A 2: 76,564,638 (GRCm39) R26754* probably null Het
Ttn G A 2: 76,727,924 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,791,358 (GRCm39) L244R probably damaging Het
Ubxn1 C T 19: 8,850,930 (GRCm39) R115* probably null Het
Umod T G 7: 119,075,938 (GRCm39) N276T probably damaging Het
Unc80 T A 1: 66,679,754 (GRCm39) H2108Q possibly damaging Het
Utp20 A C 10: 88,610,657 (GRCm39) D1442E probably damaging Het
Utp4 A G 8: 107,625,153 (GRCm39) Q144R probably benign Het
Vmn2r17 T A 5: 109,575,075 (GRCm39) N127K probably benign Het
Vmn2r75 T A 7: 85,814,372 (GRCm39) T374S probably benign Het
Washc5 A G 15: 59,222,257 (GRCm39) F523L probably damaging Het
Wdr3 A T 3: 100,067,213 (GRCm39) probably null Het
Wdr89 T C 12: 75,679,762 (GRCm39) Y164C probably damaging Het
Xpo5 T C 17: 46,536,017 (GRCm39) S550P probably damaging Het
Zfp69 T C 4: 120,788,029 (GRCm39) T429A probably damaging Het
Zfpm1 G T 8: 123,063,331 (GRCm39) G797C probably benign Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73,643,985 (GRCm39) missense probably damaging 0.99
IGL00693:Unc13c APN 9 73,665,884 (GRCm39) missense probably benign 0.18
IGL01022:Unc13c APN 9 73,424,610 (GRCm39) missense probably benign 0.06
IGL01088:Unc13c APN 9 73,839,563 (GRCm39) missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73,840,479 (GRCm39) missense probably benign 0.05
IGL01131:Unc13c APN 9 73,471,335 (GRCm39) missense probably benign
IGL01135:Unc13c APN 9 73,392,175 (GRCm39) missense probably damaging 1.00
IGL01393:Unc13c APN 9 73,447,552 (GRCm39) missense probably benign 0.06
IGL01752:Unc13c APN 9 73,839,093 (GRCm39) missense probably benign 0.01
IGL01893:Unc13c APN 9 73,600,648 (GRCm39) missense probably benign 0.15
IGL01897:Unc13c APN 9 73,453,309 (GRCm39) missense probably damaging 0.99
IGL01936:Unc13c APN 9 73,600,524 (GRCm39) missense probably benign 0.07
IGL02122:Unc13c APN 9 73,641,679 (GRCm39) splice site probably benign
IGL02341:Unc13c APN 9 73,840,492 (GRCm39) missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73,839,910 (GRCm39) missense probably benign 0.01
IGL02545:Unc13c APN 9 73,388,357 (GRCm39) missense probably damaging 0.98
IGL02709:Unc13c APN 9 73,466,238 (GRCm39) missense probably benign 0.00
IGL02815:Unc13c APN 9 73,447,545 (GRCm39) missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73,388,349 (GRCm39) nonsense probably null
IGL03117:Unc13c APN 9 73,441,307 (GRCm39) missense probably benign 0.03
IGL03260:Unc13c APN 9 73,838,626 (GRCm39) missense probably benign 0.11
Feeling UTSW 9 73,600,553 (GRCm39) missense possibly damaging 0.46
Inkling UTSW 9 73,839,126 (GRCm39) missense probably damaging 1.00
notion UTSW 9 73,643,844 (GRCm39) missense probably damaging 1.00
BB001:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
BB011:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
PIT4431001:Unc13c UTSW 9 73,656,829 (GRCm39) missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73,391,021 (GRCm39) missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73,600,583 (GRCm39) missense probably benign 0.07
R0039:Unc13c UTSW 9 73,576,847 (GRCm39) splice site probably benign
R0164:Unc13c UTSW 9 73,602,174 (GRCm39) missense probably benign 0.01
R0164:Unc13c UTSW 9 73,602,174 (GRCm39) missense probably benign 0.01
R0308:Unc13c UTSW 9 73,388,400 (GRCm39) missense probably benign 0.04
R0344:Unc13c UTSW 9 73,838,067 (GRCm39) missense probably benign 0.39
R0421:Unc13c UTSW 9 73,840,492 (GRCm39) missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73,438,265 (GRCm39) splice site probably benign
R0655:Unc13c UTSW 9 73,838,235 (GRCm39) missense probably damaging 0.96
R1013:Unc13c UTSW 9 73,840,614 (GRCm39) missense probably benign 0.45
R1293:Unc13c UTSW 9 73,481,356 (GRCm39) missense probably benign 0.06
R1493:Unc13c UTSW 9 73,546,350 (GRCm39) missense probably benign 0.27
R1675:Unc13c UTSW 9 73,546,332 (GRCm39) critical splice donor site probably null
R1789:Unc13c UTSW 9 73,663,621 (GRCm39) missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73,390,897 (GRCm39) splice site probably null
R2055:Unc13c UTSW 9 73,643,832 (GRCm39) missense probably damaging 1.00
R2420:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R2421:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R2422:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R3415:Unc13c UTSW 9 73,839,868 (GRCm39) missense probably benign 0.00
R3423:Unc13c UTSW 9 73,837,935 (GRCm39) missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73,838,240 (GRCm39) missense probably benign 0.00
R3857:Unc13c UTSW 9 73,606,390 (GRCm39) nonsense probably null
R3859:Unc13c UTSW 9 73,606,390 (GRCm39) nonsense probably null
R3895:Unc13c UTSW 9 73,840,805 (GRCm39) missense probably benign
R4038:Unc13c UTSW 9 73,441,188 (GRCm39) critical splice donor site probably null
R4077:Unc13c UTSW 9 73,643,821 (GRCm39) nonsense probably null
R4125:Unc13c UTSW 9 73,481,289 (GRCm39) critical splice donor site probably null
R4128:Unc13c UTSW 9 73,641,819 (GRCm39) missense probably damaging 1.00
R4235:Unc13c UTSW 9 73,438,234 (GRCm39) missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73,641,786 (GRCm39) missense probably damaging 1.00
R4307:Unc13c UTSW 9 73,600,649 (GRCm39) missense probably benign 0.06
R4658:Unc13c UTSW 9 73,840,108 (GRCm39) missense probably damaging 1.00
R4694:Unc13c UTSW 9 73,479,636 (GRCm39) missense probably benign 0.00
R4735:Unc13c UTSW 9 73,600,620 (GRCm39) missense probably benign 0.00
R4744:Unc13c UTSW 9 73,839,126 (GRCm39) missense probably damaging 1.00
R4795:Unc13c UTSW 9 73,839,469 (GRCm39) missense probably damaging 0.97
R4827:Unc13c UTSW 9 73,838,568 (GRCm39) missense probably damaging 1.00
R4838:Unc13c UTSW 9 73,839,354 (GRCm39) missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73,587,716 (GRCm39) missense probably benign 0.02
R4873:Unc13c UTSW 9 73,424,566 (GRCm39) missense probably damaging 0.98
R4875:Unc13c UTSW 9 73,424,566 (GRCm39) missense probably damaging 0.98
R4876:Unc13c UTSW 9 73,656,821 (GRCm39) missense probably damaging 1.00
R4905:Unc13c UTSW 9 73,587,674 (GRCm39) missense probably benign
R4912:Unc13c UTSW 9 73,481,304 (GRCm39) missense probably damaging 0.99
R5026:Unc13c UTSW 9 73,838,185 (GRCm39) missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73,840,654 (GRCm39) missense probably benign 0.26
R5151:Unc13c UTSW 9 73,838,757 (GRCm39) missense probably benign 0.02
R5171:Unc13c UTSW 9 73,665,236 (GRCm39) missense probably benign
R5244:Unc13c UTSW 9 73,433,233 (GRCm39) critical splice donor site probably null
R5342:Unc13c UTSW 9 73,838,105 (GRCm39) missense probably benign 0.00
R5399:Unc13c UTSW 9 73,656,970 (GRCm39) missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73,485,672 (GRCm39) missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73,453,271 (GRCm39) missense probably benign
R5680:Unc13c UTSW 9 73,839,884 (GRCm39) missense probably damaging 1.00
R5681:Unc13c UTSW 9 73,453,357 (GRCm39) splice site probably null
R5728:Unc13c UTSW 9 73,466,238 (GRCm39) missense probably benign 0.01
R5762:Unc13c UTSW 9 73,719,649 (GRCm39) missense probably benign 0.00
R5764:Unc13c UTSW 9 73,441,185 (GRCm39) splice site probably null
R5829:Unc13c UTSW 9 73,600,650 (GRCm39) missense probably benign 0.15
R5894:Unc13c UTSW 9 73,600,486 (GRCm39) critical splice donor site probably null
R5936:Unc13c UTSW 9 73,485,774 (GRCm39) missense probably damaging 1.00
R6043:Unc13c UTSW 9 73,643,933 (GRCm39) missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73,838,166 (GRCm39) missense probably benign
R6148:Unc13c UTSW 9 73,600,648 (GRCm39) missense probably benign 0.15
R6207:Unc13c UTSW 9 73,665,910 (GRCm39) missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73,606,451 (GRCm39) missense probably damaging 1.00
R6338:Unc13c UTSW 9 73,641,729 (GRCm39) missense probably damaging 0.99
R6615:Unc13c UTSW 9 73,837,890 (GRCm39) missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73,839,259 (GRCm39) missense probably benign 0.39
R7053:Unc13c UTSW 9 73,839,579 (GRCm39) missense probably damaging 1.00
R7223:Unc13c UTSW 9 73,536,473 (GRCm39) missense probably benign 0.44
R7259:Unc13c UTSW 9 73,424,645 (GRCm39) missense probably benign 0.00
R7353:Unc13c UTSW 9 73,481,355 (GRCm39) missense probably benign 0.00
R7357:Unc13c UTSW 9 73,840,811 (GRCm39) small insertion probably benign
R7357:Unc13c UTSW 9 73,840,810 (GRCm39) small insertion probably benign
R7607:Unc13c UTSW 9 73,576,817 (GRCm39) missense probably damaging 0.98
R7626:Unc13c UTSW 9 73,641,799 (GRCm39) missense probably damaging 1.00
R7639:Unc13c UTSW 9 73,840,450 (GRCm39) missense probably damaging 0.99
R7657:Unc13c UTSW 9 73,441,185 (GRCm39) splice site probably null
R7665:Unc13c UTSW 9 73,587,756 (GRCm39) missense probably benign 0.28
R7704:Unc13c UTSW 9 73,606,494 (GRCm39) missense probably benign 0.27
R7776:Unc13c UTSW 9 73,602,232 (GRCm39) missense probably damaging 1.00
R7811:Unc13c UTSW 9 73,600,553 (GRCm39) missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73,388,391 (GRCm39) missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73,840,596 (GRCm39) missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73,602,159 (GRCm39) missense probably damaging 1.00
R7924:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
R8047:Unc13c UTSW 9 73,719,636 (GRCm39) nonsense probably null
R8167:Unc13c UTSW 9 73,643,985 (GRCm39) missense probably damaging 0.99
R8202:Unc13c UTSW 9 73,643,844 (GRCm39) missense probably damaging 1.00
R8210:Unc13c UTSW 9 73,392,220 (GRCm39) missense probably benign 0.13
R8352:Unc13c UTSW 9 73,838,290 (GRCm39) missense probably damaging 0.99
R8368:Unc13c UTSW 9 73,838,070 (GRCm39) missense probably benign 0.15
R8452:Unc13c UTSW 9 73,838,290 (GRCm39) missense probably damaging 0.99
R8535:Unc13c UTSW 9 73,447,653 (GRCm39) missense probably benign
R8677:Unc13c UTSW 9 73,840,243 (GRCm39) missense probably benign 0.00
R8700:Unc13c UTSW 9 73,479,679 (GRCm39) missense probably benign 0.44
R8848:Unc13c UTSW 9 73,433,263 (GRCm39) missense probably benign
R8902:Unc13c UTSW 9 73,656,830 (GRCm39) missense probably damaging 0.97
R8953:Unc13c UTSW 9 73,840,044 (GRCm39) missense probably benign 0.00
R8961:Unc13c UTSW 9 73,839,524 (GRCm39) missense probably benign 0.06
R9015:Unc13c UTSW 9 73,453,322 (GRCm39) missense probably benign
R9114:Unc13c UTSW 9 73,719,665 (GRCm39) missense probably benign 0.02
R9217:Unc13c UTSW 9 73,485,715 (GRCm39) missense probably damaging 1.00
R9252:Unc13c UTSW 9 73,424,553 (GRCm39) missense possibly damaging 0.80
R9273:Unc13c UTSW 9 73,839,862 (GRCm39) missense possibly damaging 0.96
R9317:Unc13c UTSW 9 73,447,662 (GRCm39) missense possibly damaging 0.88
R9412:Unc13c UTSW 9 73,839,772 (GRCm39) missense probably benign
R9505:Unc13c UTSW 9 73,838,824 (GRCm39) missense probably benign 0.22
R9516:Unc13c UTSW 9 73,392,220 (GRCm39) missense probably damaging 0.99
R9528:Unc13c UTSW 9 73,837,960 (GRCm39) missense possibly damaging 0.48
R9567:Unc13c UTSW 9 73,536,485 (GRCm39) missense probably damaging 0.99
R9756:Unc13c UTSW 9 73,839,526 (GRCm39) missense probably benign 0.23
R9783:Unc13c UTSW 9 73,392,227 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GAGATGGGAATTCTCAAACTGTGG -3'
(R):5'- TGAGAAAACCAGGCCTACAG -3'

Sequencing Primer
(F):5'- CTGTTATTCTACGTGCATTGAAACAG -3'
(R):5'- GCAACTTGCAGGACTCAGTC -3'
Posted On 2014-09-17