Incidental Mutation 'R2060:Dlec1'
ID 228630
Institutional Source Beutler Lab
Gene Symbol Dlec1
Ensembl Gene ENSMUSG00000038060
Gene Name deleted in lung and esophageal cancer 1
Synonyms D630005C06Rik
MMRRC Submission 040065-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2060 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 118931546-118977314 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 118941154 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 235 (T235P)
Ref Sequence ENSEMBL: ENSMUSP00000128874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055775] [ENSMUST00000140326] [ENSMUST00000165231]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000055775
AA Change: T235P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052645
Gene: ENSMUSG00000038060
AA Change: T235P

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124213
Predicted Effect probably damaging
Transcript: ENSMUST00000140326
AA Change: T235P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122380
Gene: ENSMUSG00000038060
AA Change: T235P

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165231
AA Change: T235P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128874
Gene: ENSMUSG00000038060
AA Change: T235P

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1333 1354 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytogenetic location of this gene is 3p21.3, and it is located in a region that is commonly deleted in a variety of malignancies. Down-regulation of this gene has been observed in several human cancers including lung, esophageal, renal tumors, and head and neck squamous cell carcinoma. In some cases, reduced expression of this gene in tumor cells is a result of aberrant promoter methylation. Several alternatively spliced transcripts have been observed that contain disrupted coding regions and likely encode nonfunctional proteins.[provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 119,826,741 (GRCm39) W462* probably null Het
Aftph A T 11: 20,642,571 (GRCm39) Y821N probably damaging Het
Ahnak A T 19: 8,985,405 (GRCm39) M2230L probably benign Het
Arfgap1 T C 2: 180,614,575 (GRCm39) F144L probably benign Het
Arid4b C T 13: 14,370,037 (GRCm39) R1178C probably damaging Het
Asb8 A T 15: 98,039,254 (GRCm39) C49S possibly damaging Het
Baz1b A G 5: 135,233,968 (GRCm39) N165S probably damaging Het
Bod1l A T 5: 41,966,085 (GRCm39) I2660N possibly damaging Het
C2cd3 T C 7: 100,104,155 (GRCm39) I825T probably damaging Het
C4b A G 17: 34,955,075 (GRCm39) W804R probably damaging Het
Cadm3 A T 1: 173,171,969 (GRCm39) D201E probably damaging Het
Cdh17 T C 4: 11,803,982 (GRCm39) F552L probably benign Het
Cdh20 G C 1: 109,976,607 (GRCm39) A91P probably damaging Het
Cela1 A G 15: 100,573,203 (GRCm39) probably null Het
Clk3 T C 9: 57,658,400 (GRCm39) Y582C probably damaging Het
Cma1 C T 14: 56,181,155 (GRCm39) probably null Het
Ctcfl A G 2: 172,960,299 (GRCm39) S95P probably benign Het
Cylc1 C A X: 110,166,892 (GRCm39) T391K unknown Het
Cyp3a11 T A 5: 145,791,891 (GRCm39) I501L probably benign Het
Cyp3a59 T A 5: 146,041,524 (GRCm39) L356Q probably damaging Het
Dcdc2a A C 13: 25,291,693 (GRCm39) D226A possibly damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dnaaf1 G A 8: 120,317,341 (GRCm39) R290Q probably benign Het
Dnaaf5 C T 5: 139,163,758 (GRCm39) R377W probably damaging Het
Dpep1 T A 8: 123,927,130 (GRCm39) V293E probably damaging Het
Drosha T A 15: 12,924,245 (GRCm39) V1209E possibly damaging Het
Dync2h1 T G 9: 7,162,802 (GRCm39) I596L possibly damaging Het
Edem1 T A 6: 108,831,248 (GRCm39) Y570N probably damaging Het
Edrf1 G T 7: 133,258,858 (GRCm39) E9* probably null Het
Enpep T A 3: 129,074,172 (GRCm39) N792Y probably benign Het
Enpp2 A T 15: 54,739,110 (GRCm39) M391K probably damaging Het
Fanca A C 8: 124,001,220 (GRCm39) V1105G probably damaging Het
Fbxo22 T A 9: 55,125,667 (GRCm39) L74I probably damaging Het
Fchsd2 T A 7: 100,926,624 (GRCm39) F571L probably benign Het
Fhad1 T C 4: 141,626,560 (GRCm39) D1345G probably benign Het
G2e3 T C 12: 51,419,389 (GRCm39) F702L probably damaging Het
Glce A T 9: 61,968,228 (GRCm39) S308T possibly damaging Het
Glt1d1 A G 5: 127,734,183 (GRCm39) D119G probably benign Het
Gpr137c T C 14: 45,481,616 (GRCm39) I144T probably damaging Het
Gprin3 A G 6: 59,331,504 (GRCm39) C268R possibly damaging Het
Hadha G A 5: 30,333,834 (GRCm39) T395M probably benign Het
Hdhd2 T G 18: 77,052,738 (GRCm39) probably null Het
Homer2 C T 7: 81,268,451 (GRCm39) E70K probably benign Het
Hp1bp3 T A 4: 137,967,983 (GRCm39) D397E probably damaging Het
Hrh3 T C 2: 179,743,043 (GRCm39) N195S possibly damaging Het
Hyou1 T C 9: 44,292,849 (GRCm39) V153A probably benign Het
Igf2r A T 17: 12,920,206 (GRCm39) S1378T possibly damaging Het
Ints4 G A 7: 97,150,970 (GRCm39) R279H possibly damaging Het
Itga10 A T 3: 96,562,314 (GRCm39) R699* probably null Het
Itpkb A G 1: 180,249,423 (GRCm39) T933A probably benign Het
Itsn2 T G 12: 4,677,879 (GRCm39) F79V probably damaging Het
Jak3 C A 8: 72,133,358 (GRCm39) C350* probably null Het
Jak3 A T 8: 72,136,059 (GRCm39) K620* probably null Het
Kcnq5 T C 1: 21,531,821 (GRCm39) S421G probably benign Het
Kdm2b A T 5: 123,021,428 (GRCm39) M50K probably damaging Het
Klk1b1 A G 7: 43,620,047 (GRCm39) D170G possibly damaging Het
Lama3 A T 18: 12,661,783 (GRCm39) T2160S probably benign Het
Lman1 A T 18: 66,131,423 (GRCm39) probably benign Het
Lmtk3 G A 7: 45,450,335 (GRCm39) probably null Het
Ltb A G 17: 35,414,739 (GRCm39) R180G probably damaging Het
Ltbp4 C T 7: 27,008,378 (GRCm39) R1310Q probably damaging Het
Macf1 T A 4: 123,393,712 (GRCm39) probably null Het
Mast4 G T 13: 102,875,354 (GRCm39) P1146Q probably damaging Het
Micall2 C T 5: 139,697,317 (GRCm39) S678N probably damaging Het
Mon2 A T 10: 122,831,681 (GRCm39) I1675N probably damaging Het
Mug2 A G 6: 122,056,571 (GRCm39) N1172S probably benign Het
Naa30 C G 14: 49,410,556 (GRCm39) S161R possibly damaging Het
Ncaph T C 2: 126,966,795 (GRCm39) N220D probably damaging Het
Nell1 T C 7: 50,210,578 (GRCm39) V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 (GRCm38) N142S possibly damaging Het
Nin T A 12: 70,089,192 (GRCm39) T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 (GRCm38) noncoding transcript Het
Nrg1 T G 8: 32,408,043 (GRCm39) E63D probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or14j7 A G 17: 38,234,771 (GRCm39) T105A probably benign Het
Or5d39 T C 2: 87,979,487 (GRCm39) Y292C probably damaging Het
Or5g29 G A 2: 85,421,627 (GRCm39) V248I possibly damaging Het
Or5p53 C T 7: 107,532,868 (GRCm39) T47M probably benign Het
Or6ae1 T A 7: 139,742,737 (GRCm39) E42V probably damaging Het
Or7d11 A T 9: 19,965,892 (GRCm39) I289N probably damaging Het
Or7g27 A G 9: 19,250,352 (GRCm39) I199V probably benign Het
Or7g32 T A 9: 19,408,533 (GRCm39) V163E possibly damaging Het
Orc5 C T 5: 22,721,701 (GRCm39) probably null Het
Pard3 G A 8: 128,125,085 (GRCm39) R691Q probably benign Het
Pofut1 T A 2: 153,085,580 (GRCm39) D54E probably benign Het
Prl2c5 T A 13: 13,365,238 (GRCm39) V128E probably damaging Het
Ptk7 T C 17: 46,877,164 (GRCm39) M965V possibly damaging Het
Pum2 C T 12: 8,778,726 (GRCm39) R459* probably null Het
Pzp A T 6: 128,460,673 (GRCm39) N1494K probably benign Het
Rad21l A G 2: 151,487,349 (GRCm39) V545A probably benign Het
Rps6kc1 A T 1: 190,542,305 (GRCm39) M352K possibly damaging Het
Rpusd2 G A 2: 118,867,696 (GRCm39) probably null Het
Rsph14 A T 10: 74,865,603 (GRCm39) D78E probably damaging Het
Rtl9 A T X: 141,885,026 (GRCm39) M813L possibly damaging Het
Rtp4 A T 16: 23,431,690 (GRCm39) H74L probably damaging Het
Rusc1 G A 3: 88,995,155 (GRCm39) T725I possibly damaging Het
Rusf1 A G 7: 127,887,503 (GRCm39) L176P probably damaging Het
Ryr2 C T 13: 11,610,622 (GRCm39) C4068Y probably damaging Het
Ryr3 A G 2: 112,784,709 (GRCm39) V224A possibly damaging Het
Shprh A T 10: 11,027,864 (GRCm39) N157I probably benign Het
Siglece A G 7: 43,307,210 (GRCm39) I67T probably benign Het
Slc9b2 A T 3: 135,032,027 (GRCm39) T296S probably damaging Het
Sorbs2 A G 8: 46,228,666 (GRCm39) K276E probably damaging Het
Synj2 A G 17: 6,087,755 (GRCm39) T1269A probably benign Het
Taar7b T C 10: 23,876,573 (GRCm39) I246T possibly damaging Het
Taldo1 A G 7: 140,976,067 (GRCm39) Y113C probably damaging Het
Tarbp1 A T 8: 127,174,333 (GRCm39) probably null Het
Tars1 C T 15: 11,394,459 (GRCm39) M59I probably benign Het
Tas2r130 G A 6: 131,607,780 (GRCm39) T5I probably benign Het
Tex48 T C 4: 63,525,652 (GRCm39) E77G probably damaging Het
Tmco5 A G 2: 116,722,736 (GRCm39) R286G probably damaging Het
Trdmt1 A T 2: 13,524,725 (GRCm39) H243Q probably benign Het
Ttn T A 2: 76,564,638 (GRCm39) R26754* probably null Het
Ttn G A 2: 76,727,924 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,791,358 (GRCm39) L244R probably damaging Het
Ubxn1 C T 19: 8,850,930 (GRCm39) R115* probably null Het
Umod T G 7: 119,075,938 (GRCm39) N276T probably damaging Het
Unc13c A T 9: 73,572,938 (GRCm39) L1528Q probably damaging Het
Unc80 T A 1: 66,679,754 (GRCm39) H2108Q possibly damaging Het
Utp20 A C 10: 88,610,657 (GRCm39) D1442E probably damaging Het
Utp4 A G 8: 107,625,153 (GRCm39) Q144R probably benign Het
Vmn2r17 T A 5: 109,575,075 (GRCm39) N127K probably benign Het
Vmn2r75 T A 7: 85,814,372 (GRCm39) T374S probably benign Het
Washc5 A G 15: 59,222,257 (GRCm39) F523L probably damaging Het
Wdr3 A T 3: 100,067,213 (GRCm39) probably null Het
Wdr89 T C 12: 75,679,762 (GRCm39) Y164C probably damaging Het
Xpo5 T C 17: 46,536,017 (GRCm39) S550P probably damaging Het
Zfp69 T C 4: 120,788,029 (GRCm39) T429A probably damaging Het
Zfpm1 G T 8: 123,063,331 (GRCm39) G797C probably benign Het
Other mutations in Dlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Dlec1 APN 9 118,931,853 (GRCm39) missense probably benign 0.11
IGL01137:Dlec1 APN 9 118,966,379 (GRCm39) missense probably damaging 1.00
IGL01338:Dlec1 APN 9 118,949,979 (GRCm39) missense probably damaging 1.00
IGL01652:Dlec1 APN 9 118,972,975 (GRCm39) missense probably benign 0.01
IGL01923:Dlec1 APN 9 118,957,182 (GRCm39) splice site probably null
IGL02186:Dlec1 APN 9 118,972,695 (GRCm39) missense probably benign 0.00
IGL02597:Dlec1 APN 9 118,963,604 (GRCm39) missense probably damaging 0.99
IGL02667:Dlec1 APN 9 118,956,534 (GRCm39) missense probably benign 0.23
IGL02718:Dlec1 APN 9 118,966,354 (GRCm39) missense probably benign 0.01
IGL02731:Dlec1 APN 9 118,976,188 (GRCm39) missense probably benign 0.00
IGL02831:Dlec1 APN 9 118,972,983 (GRCm39) missense probably damaging 1.00
IGL03390:Dlec1 APN 9 118,952,288 (GRCm39) missense probably benign 0.00
I2288:Dlec1 UTSW 9 118,972,669 (GRCm39) missense probably damaging 1.00
R0109:Dlec1 UTSW 9 118,934,892 (GRCm39) missense probably damaging 1.00
R0144:Dlec1 UTSW 9 118,971,934 (GRCm39) missense probably benign
R0554:Dlec1 UTSW 9 118,944,070 (GRCm39) missense probably benign 0.44
R0611:Dlec1 UTSW 9 118,941,167 (GRCm39) missense probably benign 0.01
R1344:Dlec1 UTSW 9 118,959,085 (GRCm39) missense probably benign 0.09
R1467:Dlec1 UTSW 9 118,971,646 (GRCm39) missense probably damaging 1.00
R1467:Dlec1 UTSW 9 118,971,646 (GRCm39) missense probably damaging 1.00
R1467:Dlec1 UTSW 9 118,957,071 (GRCm39) splice site probably benign
R1539:Dlec1 UTSW 9 118,956,518 (GRCm39) missense probably benign 0.00
R1768:Dlec1 UTSW 9 118,975,075 (GRCm39) splice site probably null
R1809:Dlec1 UTSW 9 118,965,767 (GRCm39) missense probably benign 0.00
R1830:Dlec1 UTSW 9 118,967,858 (GRCm39) missense probably benign 0.00
R1901:Dlec1 UTSW 9 118,931,712 (GRCm39) missense probably damaging 0.99
R2092:Dlec1 UTSW 9 118,950,912 (GRCm39) missense possibly damaging 0.87
R2237:Dlec1 UTSW 9 118,967,259 (GRCm39) critical splice donor site probably null
R2983:Dlec1 UTSW 9 118,975,241 (GRCm39) missense probably benign 0.00
R3117:Dlec1 UTSW 9 118,972,971 (GRCm39) splice site probably null
R3816:Dlec1 UTSW 9 118,953,911 (GRCm39) missense probably damaging 1.00
R3826:Dlec1 UTSW 9 118,972,129 (GRCm39) splice site probably benign
R3965:Dlec1 UTSW 9 118,957,649 (GRCm39) missense probably benign 0.01
R4023:Dlec1 UTSW 9 118,966,408 (GRCm39) missense probably damaging 0.98
R4024:Dlec1 UTSW 9 118,966,408 (GRCm39) missense probably damaging 0.98
R4026:Dlec1 UTSW 9 118,966,408 (GRCm39) missense probably damaging 0.98
R4272:Dlec1 UTSW 9 118,972,231 (GRCm39) missense probably damaging 0.98
R4545:Dlec1 UTSW 9 118,957,146 (GRCm39) missense probably damaging 0.99
R4546:Dlec1 UTSW 9 118,957,146 (GRCm39) missense probably damaging 0.99
R4601:Dlec1 UTSW 9 118,976,202 (GRCm39) critical splice donor site probably null
R4695:Dlec1 UTSW 9 118,972,221 (GRCm39) missense probably benign 0.00
R4996:Dlec1 UTSW 9 118,975,118 (GRCm39) missense probably damaging 1.00
R5321:Dlec1 UTSW 9 118,941,669 (GRCm39) missense probably benign 0.02
R5521:Dlec1 UTSW 9 118,972,469 (GRCm39) missense possibly damaging 0.92
R5650:Dlec1 UTSW 9 118,972,662 (GRCm39) nonsense probably null
R5825:Dlec1 UTSW 9 118,972,036 (GRCm39) missense probably damaging 1.00
R5941:Dlec1 UTSW 9 118,955,380 (GRCm39) missense probably damaging 0.98
R6056:Dlec1 UTSW 9 118,950,991 (GRCm39) missense probably damaging 0.98
R6111:Dlec1 UTSW 9 118,931,692 (GRCm39) missense possibly damaging 0.59
R6156:Dlec1 UTSW 9 118,939,281 (GRCm39) critical splice donor site probably null
R6160:Dlec1 UTSW 9 118,972,387 (GRCm39) missense probably benign 0.02
R6195:Dlec1 UTSW 9 118,966,321 (GRCm39) missense probably benign 0.00
R6364:Dlec1 UTSW 9 118,950,939 (GRCm39) missense possibly damaging 0.84
R6480:Dlec1 UTSW 9 118,976,758 (GRCm39) missense probably benign 0.34
R6808:Dlec1 UTSW 9 118,955,242 (GRCm39) missense probably benign 0.01
R6813:Dlec1 UTSW 9 118,941,170 (GRCm39) missense probably benign 0.02
R7019:Dlec1 UTSW 9 118,941,490 (GRCm39) missense probably benign 0.01
R7048:Dlec1 UTSW 9 118,972,472 (GRCm39) splice site probably null
R7187:Dlec1 UTSW 9 118,941,214 (GRCm39) missense probably benign 0.14
R7230:Dlec1 UTSW 9 118,953,606 (GRCm39) splice site probably null
R7585:Dlec1 UTSW 9 118,971,819 (GRCm39) missense probably benign 0.06
R8342:Dlec1 UTSW 9 118,968,457 (GRCm39) missense probably benign 0.01
R8480:Dlec1 UTSW 9 118,972,335 (GRCm39) splice site probably null
R8481:Dlec1 UTSW 9 118,972,335 (GRCm39) splice site probably null
R8485:Dlec1 UTSW 9 118,957,659 (GRCm39) missense probably benign 0.33
R8520:Dlec1 UTSW 9 118,941,277 (GRCm39) missense probably benign 0.00
R8556:Dlec1 UTSW 9 118,955,289 (GRCm39) missense probably benign 0.13
R8755:Dlec1 UTSW 9 118,967,225 (GRCm39) missense probably damaging 1.00
R8805:Dlec1 UTSW 9 118,941,650 (GRCm39) missense probably benign
R8813:Dlec1 UTSW 9 118,956,498 (GRCm39) missense probably benign 0.16
R8983:Dlec1 UTSW 9 118,957,419 (GRCm39) missense probably benign 0.00
R9040:Dlec1 UTSW 9 118,950,985 (GRCm39) missense probably benign 0.04
R9085:Dlec1 UTSW 9 118,953,252 (GRCm39) missense probably damaging 1.00
R9452:Dlec1 UTSW 9 118,941,541 (GRCm39) missense probably benign 0.05
R9467:Dlec1 UTSW 9 118,971,652 (GRCm39) missense probably damaging 1.00
R9612:Dlec1 UTSW 9 118,956,533 (GRCm39) missense probably damaging 0.98
Z1176:Dlec1 UTSW 9 118,967,854 (GRCm39) missense probably benign 0.13
Z1177:Dlec1 UTSW 9 118,976,477 (GRCm39) missense probably damaging 0.99
Z1177:Dlec1 UTSW 9 118,963,541 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AGCCCTATGTCTCAAACACATGG -3'
(R):5'- TGCCCTAACATAGCTCAGTTCTAAC -3'

Sequencing Primer
(F):5'- GTCCCAGGAATAACTCATGCATTG -3'
(R):5'- AACCTTGACAGAATCTGTGGTCC -3'
Posted On 2014-09-17