Mutagenetix > Incidental Mutation

Incidental Mutation 'R2060:Utp20'

228637

Institutional Source

Beutler Lab

Gene Symbol

Utp20

Ensembl Gene

ENSMUSG00000004356

Gene Name

UTP20 small subunit processome component

Synonyms

3830408P06Rik, DRIM, mDRIM

MMRRC Submission

040065-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R2060 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88746607-88826804 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 88774795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1442 (D1442E)

Ref Sequence

ENSEMBL: ENSMUSP00000004470 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004470]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000004470
AA Change: D1442E

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: D1442E

Domain	Start	End	E-Value	Type
low complexity region	244	255	N/A	INTRINSIC
low complexity region	442	454	N/A	INTRINSIC
low complexity region	571	581	N/A	INTRINSIC
low complexity region	695	704	N/A	INTRINSIC
Pfam:DRIM	910	1534	2.6e-176	PFAM
low complexity region	1585	1598	N/A	INTRINSIC
low complexity region	1705	1719	N/A	INTRINSIC
low complexity region	2503	2513	N/A	INTRINSIC
low complexity region	2589	2605	N/A	INTRINSIC
low complexity region	2727	2737	N/A	INTRINSIC
low complexity region	2746	2764	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219662

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220275

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 129 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8430408G22Rik	G	A	6: 116,651,722	V9M	possibly damaging	Het
Abca14	G	A	7: 120,227,518	W462*	probably null	Het
Aftph	A	T	11: 20,692,571	Y821N	probably damaging	Het
Ahnak	A	T	19: 9,008,041	M2230L	probably benign	Het
Arfgap1	T	C	2: 180,972,782	F144L	probably benign	Het
Arid4b	C	T	13: 14,195,452	R1178C	probably damaging	Het
Asb8	A	T	15: 98,141,373	C49S	possibly damaging	Het
Baz1b	A	G	5: 135,205,114	N165S	probably damaging	Het
BC017158	A	G	7: 128,288,331	L176P	probably damaging	Het
Bod1l	A	T	5: 41,808,742	I2660N	possibly damaging	Het
C2cd3	T	C	7: 100,454,948	I825T	probably damaging	Het
C4b	A	G	17: 34,736,101	W804R	probably damaging	Het
Cadm3	A	T	1: 173,344,402	D201E	probably damaging	Het
Cdh17	T	C	4: 11,803,982	F552L	probably benign	Het
Cdh7	G	C	1: 110,048,877	A91P	probably damaging	Het
Cela1	A	G	15: 100,675,322		probably null	Het
Clk3	T	C	9: 57,751,117	Y582C	probably damaging	Het
Cma1	C	T	14: 55,943,698		probably null	Het
Ctcfl	A	G	2: 173,118,506	S95P	probably benign	Het
Cylc1	C	A	X: 111,123,123	T391K	unknown	Het
Cyp3a11	T	A	5: 145,855,081	I501L	probably benign	Het
Cyp3a59	T	A	5: 146,104,714	L356Q	probably damaging	Het
Dcdc2a	A	C	13: 25,107,710	D226A	possibly damaging	Het
Dlec1	A	C	9: 119,112,086	T235P	probably damaging	Het
Dnaaf1	G	A	8: 119,590,602	R290Q	probably benign	Het
Dnaaf5	C	T	5: 139,178,003	R377W	probably damaging	Het
Dpep1	T	A	8: 123,200,391	V293E	probably damaging	Het
Drosha	T	A	15: 12,924,159	V1209E	possibly damaging	Het
Dync2h1	T	G	9: 7,162,802	I596L	possibly damaging	Het
Edem1	T	A	6: 108,854,287	Y570N	probably damaging	Het
Edrf1	G	T	7: 133,657,129	E9*	probably null	Het
Enpep	T	A	3: 129,280,523	N792Y	probably benign	Het
Enpp2	A	T	15: 54,875,714	M391K	probably damaging	Het
Fanca	A	C	8: 123,274,481	V1105G	probably damaging	Het
Fbxo22	T	A	9: 55,218,383	L74I	probably damaging	Het
Fchsd2	T	A	7: 101,277,417	F571L	probably benign	Het
Fhad1	T	C	4: 141,899,249	D1345G	probably benign	Het
G2e3	T	C	12: 51,372,606	F702L	probably damaging	Het
Glce	A	T	9: 62,060,946	S308T	possibly damaging	Het
Glt1d1	A	G	5: 127,657,119	D119G	probably benign	Het
Gpr137c	T	C	14: 45,244,159	I144T	probably damaging	Het
Gprin3	A	G	6: 59,354,519	C268R	possibly damaging	Het
Hadha	G	A	5: 30,128,836	T395M	probably benign	Het
Hdhd2	T	G	18: 76,965,042		probably null	Het
Homer2	C	T	7: 81,618,703	E70K	probably benign	Het
Hp1bp3	T	A	4: 138,240,672	D397E	probably damaging	Het
Hrh3	T	C	2: 180,101,250	N195S	possibly damaging	Het
Hyou1	T	C	9: 44,381,552	V153A	probably benign	Het
Igf2r	A	T	17: 12,701,319	S1378T	possibly damaging	Het
Ints4	G	A	7: 97,501,763	R279H	possibly damaging	Het
Itga10	A	T	3: 96,654,998	R699*	probably null	Het
Itpkb	A	G	1: 180,421,858	T933A	probably benign	Het
Itsn2	T	G	12: 4,627,879	F79V	probably damaging	Het
Jak3	C	A	8: 71,680,714	C350*	probably null	Het
Jak3	A	T	8: 71,683,415	K620*	probably null	Het
Kcnq5	T	C	1: 21,461,597	S421G	probably benign	Het
Kdm2b	A	T	5: 122,883,365	M50K	probably damaging	Het
Klk1b1	A	G	7: 43,970,623	D170G	possibly damaging	Het
Lama3	A	T	18: 12,528,726	T2160S	probably benign	Het
Lman1	A	T	18: 65,998,352		probably benign	Het
Lmtk3	G	A	7: 45,800,911		probably null	Het
Ltb	A	G	17: 35,195,763	R180G	probably damaging	Het
Ltbp4	C	T	7: 27,308,953	R1310Q	probably damaging	Het
Macf1	T	A	4: 123,499,919		probably null	Het
Mast4	G	T	13: 102,738,846	P1146Q	probably damaging	Het
Micall2	C	T	5: 139,711,562	S678N	probably damaging	Het
Mon2	A	T	10: 122,995,776	I1675N	probably damaging	Het
Mug2	A	G	6: 122,079,612	N1172S	probably benign	Het
Naa30	C	G	14: 49,173,099	S161R	possibly damaging	Het
Ncaph	T	C	2: 127,124,875	N220D	probably damaging	Het
Nell1	T	C	7: 50,560,830	V497A	possibly damaging	Het
Ngly1	A	G	14: 16,277,877	N142S	possibly damaging	Het
Nin	T	A	12: 70,042,418	T1408S	possibly damaging	Het
Nlrp4g	T	A	9: 124,349,693		noncoding transcript	Het
Nrg1	T	G	8: 31,918,015	E63D	probably damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr1167	T	C	2: 88,149,143	Y292C	probably damaging	Het
Olfr128	A	G	17: 37,923,880	T105A	probably benign	Het
Olfr473	C	T	7: 107,933,661	T47M	probably benign	Het
Olfr522	T	A	7: 140,162,824	E42V	probably damaging	Het
Olfr845	A	G	9: 19,339,056	I199V	probably benign	Het
Olfr851	T	A	9: 19,497,237	V163E	possibly damaging	Het
Olfr867	A	T	9: 20,054,596	I289N	probably damaging	Het
Olfr998	G	A	2: 85,591,283	V248I	possibly damaging	Het
Orc5	C	T	5: 22,516,703		probably null	Het
Pard3	G	A	8: 127,398,604	R691Q	probably benign	Het
Pofut1	T	A	2: 153,243,660	D54E	probably benign	Het
Prl2c5	T	A	13: 13,190,653	V128E	probably damaging	Het
Ptk7	T	C	17: 46,566,238	M965V	possibly damaging	Het
Pum2	C	T	12: 8,728,726	R459*	probably null	Het
Pzp	A	T	6: 128,483,710	N1494K	probably benign	Het
Rad21l	A	G	2: 151,645,429	V545A	probably benign	Het
Rps6kc1	A	T	1: 190,810,108	M352K	possibly damaging	Het
Rpusd2	G	A	2: 119,037,215		probably null	Het
Rsph14	A	T	10: 75,029,771	D78E	probably damaging	Het
Rtl9	A	T	X: 143,102,030	M813L	possibly damaging	Het
Rtp4	A	T	16: 23,612,940	H74L	probably damaging	Het
Rusc1	G	A	3: 89,087,848	T725I	possibly damaging	Het
Ryr2	C	T	13: 11,595,736	C4068Y	probably damaging	Het
Ryr3	A	G	2: 112,954,364	V224A	possibly damaging	Het
Shprh	A	T	10: 11,152,120	N157I	probably benign	Het
Siglece	A	G	7: 43,657,786	I67T	probably benign	Het
Slc9b2	A	T	3: 135,326,266	T296S	probably damaging	Het
Sorbs2	A	G	8: 45,775,629	K276E	probably damaging	Het
Synj2	A	G	17: 6,037,480	T1269A	probably benign	Het
Taar7b	T	C	10: 24,000,675	I246T	possibly damaging	Het
Taldo1	A	G	7: 141,396,154	Y113C	probably damaging	Het
Tarbp1	A	T	8: 126,447,594		probably null	Het
Tars	C	T	15: 11,394,373	M59I	probably benign	Het
Tas2r130	G	A	6: 131,630,817	T5I	probably benign	Het
Tex48	T	C	4: 63,607,415	E77G	probably damaging	Het
Tmco5	A	G	2: 116,892,255	R286G	probably damaging	Het
Trdmt1	A	T	2: 13,519,914	H243Q	probably benign	Het
Ttn	T	A	2: 76,734,294	R26754*	probably null	Het
Ttn	G	A	2: 76,897,580		probably benign	Het
Ubqln3	A	C	7: 104,142,151	L244R	probably damaging	Het
Ubxn1	C	T	19: 8,873,566	R115*	probably null	Het
Umod	T	G	7: 119,476,715	N276T	probably damaging	Het
Unc13c	A	T	9: 73,665,656	L1528Q	probably damaging	Het
Unc80	T	A	1: 66,640,595	H2108Q	possibly damaging	Het
Utp4	A	G	8: 106,898,521	Q144R	probably benign	Het
Vmn2r17	T	A	5: 109,427,209	N127K	probably benign	Het
Vmn2r75	T	A	7: 86,165,164	T374S	probably benign	Het
Washc5	A	G	15: 59,350,408	F523L	probably damaging	Het
Wdr3	A	T	3: 100,159,897		probably null	Het
Wdr89	T	C	12: 75,632,988	Y164C	probably damaging	Het
Xpo5	T	C	17: 46,225,091	S550P	probably damaging	Het
Zfp69	T	C	4: 120,930,832	T429A	probably damaging	Het
Zfpm1	G	T	8: 122,336,592	G797C	probably benign	Het

Other mutations in Utp20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Utp20	APN	10	88825444	missense	possibly damaging	0.90
IGL00858:Utp20	APN	10	88809125	missense	possibly damaging	0.69
IGL00858:Utp20	APN	10	88809138	missense	probably benign
IGL00946:Utp20	APN	10	88748315	missense	possibly damaging	0.82
IGL01061:Utp20	APN	10	88770704	missense	probably benign	0.13
IGL01399:Utp20	APN	10	88758302	critical splice donor site	probably null
IGL01548:Utp20	APN	10	88764781	missense	probably damaging	1.00
IGL01587:Utp20	APN	10	88787535	missense	probably damaging	0.98
IGL01789:Utp20	APN	10	88798279	critical splice donor site	probably null
IGL01819:Utp20	APN	10	88792687	missense	probably damaging	1.00
IGL02070:Utp20	APN	10	88821877	splice site	probably benign
IGL02231:Utp20	APN	10	88791168	missense	probably damaging	1.00
IGL02244:Utp20	APN	10	88815956	splice site	probably benign
IGL02367:Utp20	APN	10	88771853	unclassified	probably benign
IGL02553:Utp20	APN	10	88764795	missense	probably damaging	0.99
IGL02748:Utp20	APN	10	88817295	missense	probably benign	0.00
IGL02831:Utp20	APN	10	88815908	missense	probably benign
IGL02986:Utp20	APN	10	88775285	missense	probably damaging	1.00
IGL02997:Utp20	APN	10	88814034	missense	probably benign
IGL03105:Utp20	APN	10	88791096	missense	probably benign	0.10
IGL03251:Utp20	APN	10	88817326	critical splice acceptor site	probably null
IGL03337:Utp20	APN	10	88754566	missense	probably benign
IGL03348:Utp20	APN	10	88758317	missense	probably benign	0.09
IGL03381:Utp20	APN	10	88822005	missense	probably damaging	0.99
Bell	UTSW	10	88792625	missense	probably benign	0.29
elite	UTSW	10	88770808	missense	probably benign
Margin	UTSW	10	88768679	missense	probably benign	0.04
Percentile	UTSW	10	88775318	missense	probably damaging	1.00
R0037:Utp20	UTSW	10	88798404	missense	probably benign	0.05
R0107:Utp20	UTSW	10	88778391	missense	probably benign	0.03
R0197:Utp20	UTSW	10	88777516	missense	probably benign	0.22
R0219:Utp20	UTSW	10	88764675	missense	probably damaging	1.00
R0315:Utp20	UTSW	10	88807421	missense	probably damaging	1.00
R0328:Utp20	UTSW	10	88767107	missense	possibly damaging	0.82
R0329:Utp20	UTSW	10	88817979	missense	probably benign	0.00
R0330:Utp20	UTSW	10	88817979	missense	probably benign	0.00
R0395:Utp20	UTSW	10	88818595	missense	probably damaging	1.00
R0399:Utp20	UTSW	10	88820979	missense	probably damaging	1.00
R0454:Utp20	UTSW	10	88822069	missense	probably benign	0.00
R0456:Utp20	UTSW	10	88754573	missense	possibly damaging	0.92
R0491:Utp20	UTSW	10	88760912	missense	probably damaging	1.00
R0557:Utp20	UTSW	10	88748311	missense	probably damaging	0.99
R0600:Utp20	UTSW	10	88767461	missense	probably damaging	1.00
R0616:Utp20	UTSW	10	88770751	missense	probably benign	0.14
R1076:Utp20	UTSW	10	88772459	missense	probably benign	0.36
R1076:Utp20	UTSW	10	88772543	missense	possibly damaging	0.86
R1330:Utp20	UTSW	10	88801189	missense	probably damaging	0.96
R1440:Utp20	UTSW	10	88819339	missense	probably benign	0.19
R1529:Utp20	UTSW	10	88753006	missense	probably damaging	1.00
R1554:Utp20	UTSW	10	88764737	nonsense	probably null
R1621:Utp20	UTSW	10	88762871	missense	probably benign
R1641:Utp20	UTSW	10	88757972	missense	possibly damaging	0.82
R1709:Utp20	UTSW	10	88749297	missense	probably benign	0.29
R1734:Utp20	UTSW	10	88767461	missense	probably damaging	1.00
R1755:Utp20	UTSW	10	88809769	missense	probably benign	0.01
R1775:Utp20	UTSW	10	88770808	missense	probably benign
R1866:Utp20	UTSW	10	88762770	nonsense	probably null
R1867:Utp20	UTSW	10	88749443	missense	probably benign
R1901:Utp20	UTSW	10	88753026	missense	probably benign	0.02
R1902:Utp20	UTSW	10	88753026	missense	probably benign	0.02
R1967:Utp20	UTSW	10	88816979	missense	probably benign	0.03
R2102:Utp20	UTSW	10	88772917	missense	probably damaging	0.99
R2110:Utp20	UTSW	10	88767451	critical splice donor site	probably null
R2115:Utp20	UTSW	10	88786003	missense	probably benign	0.02
R2128:Utp20	UTSW	10	88814055	missense	probably damaging	0.99
R2129:Utp20	UTSW	10	88814055	missense	probably damaging	0.99
R2180:Utp20	UTSW	10	88820939	missense	probably damaging	0.98
R2280:Utp20	UTSW	10	88825503	splice site	probably null
R2435:Utp20	UTSW	10	88820891	missense	possibly damaging	0.89
R2914:Utp20	UTSW	10	88754475	critical splice donor site	probably null
R3005:Utp20	UTSW	10	88777455	missense	probably damaging	0.97
R3546:Utp20	UTSW	10	88782689	missense	probably damaging	1.00
R3547:Utp20	UTSW	10	88782689	missense	probably damaging	1.00
R3622:Utp20	UTSW	10	88757993	unclassified	probably benign
R3737:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R3738:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R3841:Utp20	UTSW	10	88775203	unclassified	probably benign
R4034:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R4035:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R4157:Utp20	UTSW	10	88761867	missense	probably benign
R4243:Utp20	UTSW	10	88807325	critical splice donor site	probably null
R4295:Utp20	UTSW	10	88754519	missense	possibly damaging	0.54
R4632:Utp20	UTSW	10	88778261	missense	probably damaging	1.00
R4633:Utp20	UTSW	10	88752952	missense	probably benign
R4684:Utp20	UTSW	10	88807445	nonsense	probably null
R4731:Utp20	UTSW	10	88754520	missense	possibly damaging	0.93
R4735:Utp20	UTSW	10	88816918	missense	possibly damaging	0.91
R4772:Utp20	UTSW	10	88809935	missense	probably benign	0.09
R4912:Utp20	UTSW	10	88771960	missense	probably benign	0.01
R4974:Utp20	UTSW	10	88816949	missense	probably benign	0.08
R4991:Utp20	UTSW	10	88746934	missense	probably benign	0.09
R5004:Utp20	UTSW	10	88748273	missense	probably damaging	0.98
R5037:Utp20	UTSW	10	88775330	missense	probably benign	0.00
R5043:Utp20	UTSW	10	88798746	missense	possibly damaging	0.70
R5108:Utp20	UTSW	10	88768873	missense	probably benign	0.00
R5138:Utp20	UTSW	10	88747377	missense	probably damaging	0.96
R5252:Utp20	UTSW	10	88750670	missense	probably benign	0.01
R5394:Utp20	UTSW	10	88772915	nonsense	probably null
R5470:Utp20	UTSW	10	88817896	missense	probably benign	0.14
R5558:Utp20	UTSW	10	88751467	missense	probably damaging	1.00
R5678:Utp20	UTSW	10	88809117	missense	probably benign	0.00
R5822:Utp20	UTSW	10	88817285	missense	probably benign	0.00
R5866:Utp20	UTSW	10	88772559	missense	possibly damaging	0.82
R5924:Utp20	UTSW	10	88815922	missense	probably benign	0.00
R6026:Utp20	UTSW	10	88768679	missense	probably benign	0.04
R6363:Utp20	UTSW	10	88757080	missense	probably damaging	1.00
R6434:Utp20	UTSW	10	88772533	nonsense	probably null
R6477:Utp20	UTSW	10	88768918	missense	probably benign	0.05
R6480:Utp20	UTSW	10	88755186	critical splice donor site	probably null
R6989:Utp20	UTSW	10	88778240	missense	probably benign	0.00
R7033:Utp20	UTSW	10	88754475	critical splice donor site	probably null
R7192:Utp20	UTSW	10	88772459	missense	probably benign	0.09
R7236:Utp20	UTSW	10	88749342	missense	probably benign	0.28
R7260:Utp20	UTSW	10	88751472	missense	probably benign	0.39
R7296:Utp20	UTSW	10	88770724	missense	probably benign	0.21
R7317:Utp20	UTSW	10	88762935	missense	possibly damaging	0.83
R7318:Utp20	UTSW	10	88813949	missense	possibly damaging	0.89
R7330:Utp20	UTSW	10	88787562	frame shift	probably null
R7367:Utp20	UTSW	10	88795443	missense	probably benign	0.21
R7432:Utp20	UTSW	10	88798398	missense	probably benign	0.00
R7447:Utp20	UTSW	10	88772492	missense	probably damaging	1.00
R7473:Utp20	UTSW	10	88820710	splice site	probably null
R7520:Utp20	UTSW	10	88818595	missense	probably damaging	1.00
R7530:Utp20	UTSW	10	88753006	missense	probably damaging	1.00
R7539:Utp20	UTSW	10	88791745	missense	probably damaging	1.00
R7651:Utp20	UTSW	10	88754595	missense	probably benign	0.41
R7728:Utp20	UTSW	10	88798341	missense	probably damaging	1.00
R7831:Utp20	UTSW	10	88762770	nonsense	probably null
R7833:Utp20	UTSW	10	88801136	missense	possibly damaging	0.92
R7909:Utp20	UTSW	10	88775330	missense	probably benign
R7956:Utp20	UTSW	10	88782614	missense	probably benign	0.23
R7999:Utp20	UTSW	10	88770388	missense	probably benign
R8080:Utp20	UTSW	10	88782715	missense	possibly damaging	0.82
R8098:Utp20	UTSW	10	88752948	missense	probably benign	0.13
R8104:Utp20	UTSW	10	88757904	missense	probably damaging	1.00
R8129:Utp20	UTSW	10	88792625	missense	probably benign	0.29
R8147:Utp20	UTSW	10	88758444	missense	probably benign	0.02
R8199:Utp20	UTSW	10	88798475	missense	probably benign
R8222:Utp20	UTSW	10	88778372	missense	probably damaging	1.00
R8415:Utp20	UTSW	10	88826604	critical splice donor site	probably null
R8466:Utp20	UTSW	10	88818503	missense	probably damaging	1.00
R8505:Utp20	UTSW	10	88818008	missense	probably benign	0.03
R8774:Utp20	UTSW	10	88752901	splice site	probably benign
R8802:Utp20	UTSW	10	88747295	missense	probably damaging	1.00
R8923:Utp20	UTSW	10	88791742	nonsense	probably null
R8945:Utp20	UTSW	10	88792670	nonsense	probably null
R9065:Utp20	UTSW	10	88757110	missense	probably benign	0.32
R9092:Utp20	UTSW	10	88768817	missense	probably benign
R9092:Utp20	UTSW	10	88775318	missense	probably damaging	1.00
R9094:Utp20	UTSW	10	88775318	missense	probably damaging	1.00
R9095:Utp20	UTSW	10	88775318	missense	probably damaging	1.00
R9096:Utp20	UTSW	10	88775318	missense	probably damaging	1.00
R9229:Utp20	UTSW	10	88758377	missense	possibly damaging	0.86
R9323:Utp20	UTSW	10	88747308	missense	probably damaging	1.00
R9336:Utp20	UTSW	10	88813936	missense	probably damaging	1.00
R9467:Utp20	UTSW	10	88804528	missense	possibly damaging	0.68
R9545:Utp20	UTSW	10	88782649	missense	probably benign	0.38
R9659:Utp20	UTSW	10	88817309	missense	probably damaging	1.00
R9788:Utp20	UTSW	10	88817309	missense	probably damaging	1.00
RF005:Utp20	UTSW	10	88825457	missense	probably damaging	1.00
RF024:Utp20	UTSW	10	88825457	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAAACAGCCCAAGGGTCTG -3'
(R):5'- AGCCAGAAATGCTGCCTATTAAC -3'

Sequencing Primer
(F):5'- CCAAGGGTCTGCCATGAC -3'
(R):5'- AAACATATTGCCCTTTCCTTTCAGAG -3'

Posted On

2014-09-17