Incidental Mutation 'R2060:Utp20'
ID 228637
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene Name UTP20 small subunit processome component
Synonyms 3830408P06Rik, DRIM, mDRIM
MMRRC Submission 040065-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock # R2060 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 88746607-88826804 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 88774795 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1442 (D1442E)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000004470
AA Change: D1442E

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: D1442E

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220275
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abca14 G A 7: 120,227,518 W462* probably null Het
Aftph A T 11: 20,692,571 Y821N probably damaging Het
Ahnak A T 19: 9,008,041 M2230L probably benign Het
Arfgap1 T C 2: 180,972,782 F144L probably benign Het
Arid4b C T 13: 14,195,452 R1178C probably damaging Het
Asb8 A T 15: 98,141,373 C49S possibly damaging Het
Baz1b A G 5: 135,205,114 N165S probably damaging Het
BC017158 A G 7: 128,288,331 L176P probably damaging Het
Bod1l A T 5: 41,808,742 I2660N possibly damaging Het
C2cd3 T C 7: 100,454,948 I825T probably damaging Het
C4b A G 17: 34,736,101 W804R probably damaging Het
Cadm3 A T 1: 173,344,402 D201E probably damaging Het
Cdh17 T C 4: 11,803,982 F552L probably benign Het
Cdh7 G C 1: 110,048,877 A91P probably damaging Het
Cela1 A G 15: 100,675,322 probably null Het
Clk3 T C 9: 57,751,117 Y582C probably damaging Het
Cma1 C T 14: 55,943,698 probably null Het
Ctcfl A G 2: 173,118,506 S95P probably benign Het
Cylc1 C A X: 111,123,123 T391K unknown Het
Cyp3a11 T A 5: 145,855,081 I501L probably benign Het
Cyp3a59 T A 5: 146,104,714 L356Q probably damaging Het
Dcdc2a A C 13: 25,107,710 D226A possibly damaging Het
Dlec1 A C 9: 119,112,086 T235P probably damaging Het
Dnaaf1 G A 8: 119,590,602 R290Q probably benign Het
Dnaaf5 C T 5: 139,178,003 R377W probably damaging Het
Dpep1 T A 8: 123,200,391 V293E probably damaging Het
Drosha T A 15: 12,924,159 V1209E possibly damaging Het
Dync2h1 T G 9: 7,162,802 I596L possibly damaging Het
Edem1 T A 6: 108,854,287 Y570N probably damaging Het
Edrf1 G T 7: 133,657,129 E9* probably null Het
Enpep T A 3: 129,280,523 N792Y probably benign Het
Enpp2 A T 15: 54,875,714 M391K probably damaging Het
Fanca A C 8: 123,274,481 V1105G probably damaging Het
Fbxo22 T A 9: 55,218,383 L74I probably damaging Het
Fchsd2 T A 7: 101,277,417 F571L probably benign Het
Fhad1 T C 4: 141,899,249 D1345G probably benign Het
G2e3 T C 12: 51,372,606 F702L probably damaging Het
Glce A T 9: 62,060,946 S308T possibly damaging Het
Glt1d1 A G 5: 127,657,119 D119G probably benign Het
Gpr137c T C 14: 45,244,159 I144T probably damaging Het
Gprin3 A G 6: 59,354,519 C268R possibly damaging Het
Hadha G A 5: 30,128,836 T395M probably benign Het
Hdhd2 T G 18: 76,965,042 probably null Het
Homer2 C T 7: 81,618,703 E70K probably benign Het
Hp1bp3 T A 4: 138,240,672 D397E probably damaging Het
Hrh3 T C 2: 180,101,250 N195S possibly damaging Het
Hyou1 T C 9: 44,381,552 V153A probably benign Het
Igf2r A T 17: 12,701,319 S1378T possibly damaging Het
Ints4 G A 7: 97,501,763 R279H possibly damaging Het
Itga10 A T 3: 96,654,998 R699* probably null Het
Itpkb A G 1: 180,421,858 T933A probably benign Het
Itsn2 T G 12: 4,627,879 F79V probably damaging Het
Jak3 C A 8: 71,680,714 C350* probably null Het
Jak3 A T 8: 71,683,415 K620* probably null Het
Kcnq5 T C 1: 21,461,597 S421G probably benign Het
Kdm2b A T 5: 122,883,365 M50K probably damaging Het
Klk1b1 A G 7: 43,970,623 D170G possibly damaging Het
Lama3 A T 18: 12,528,726 T2160S probably benign Het
Lman1 A T 18: 65,998,352 probably benign Het
Lmtk3 G A 7: 45,800,911 probably null Het
Ltb A G 17: 35,195,763 R180G probably damaging Het
Ltbp4 C T 7: 27,308,953 R1310Q probably damaging Het
Macf1 T A 4: 123,499,919 probably null Het
Mast4 G T 13: 102,738,846 P1146Q probably damaging Het
Micall2 C T 5: 139,711,562 S678N probably damaging Het
Mon2 A T 10: 122,995,776 I1675N probably damaging Het
Mug2 A G 6: 122,079,612 N1172S probably benign Het
Naa30 C G 14: 49,173,099 S161R possibly damaging Het
Ncaph T C 2: 127,124,875 N220D probably damaging Het
Nell1 T C 7: 50,560,830 V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 N142S possibly damaging Het
Nin T A 12: 70,042,418 T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 noncoding transcript Het
Nrg1 T G 8: 31,918,015 E63D probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1167 T C 2: 88,149,143 Y292C probably damaging Het
Olfr128 A G 17: 37,923,880 T105A probably benign Het
Olfr473 C T 7: 107,933,661 T47M probably benign Het
Olfr522 T A 7: 140,162,824 E42V probably damaging Het
Olfr845 A G 9: 19,339,056 I199V probably benign Het
Olfr851 T A 9: 19,497,237 V163E possibly damaging Het
Olfr867 A T 9: 20,054,596 I289N probably damaging Het
Olfr998 G A 2: 85,591,283 V248I possibly damaging Het
Orc5 C T 5: 22,516,703 probably null Het
Pard3 G A 8: 127,398,604 R691Q probably benign Het
Pofut1 T A 2: 153,243,660 D54E probably benign Het
Prl2c5 T A 13: 13,190,653 V128E probably damaging Het
Ptk7 T C 17: 46,566,238 M965V possibly damaging Het
Pum2 C T 12: 8,728,726 R459* probably null Het
Pzp A T 6: 128,483,710 N1494K probably benign Het
Rad21l A G 2: 151,645,429 V545A probably benign Het
Rps6kc1 A T 1: 190,810,108 M352K possibly damaging Het
Rpusd2 G A 2: 119,037,215 probably null Het
Rsph14 A T 10: 75,029,771 D78E probably damaging Het
Rtl9 A T X: 143,102,030 M813L possibly damaging Het
Rtp4 A T 16: 23,612,940 H74L probably damaging Het
Rusc1 G A 3: 89,087,848 T725I possibly damaging Het
Ryr2 C T 13: 11,595,736 C4068Y probably damaging Het
Ryr3 A G 2: 112,954,364 V224A possibly damaging Het
Shprh A T 10: 11,152,120 N157I probably benign Het
Siglece A G 7: 43,657,786 I67T probably benign Het
Slc9b2 A T 3: 135,326,266 T296S probably damaging Het
Sorbs2 A G 8: 45,775,629 K276E probably damaging Het
Synj2 A G 17: 6,037,480 T1269A probably benign Het
Taar7b T C 10: 24,000,675 I246T possibly damaging Het
Taldo1 A G 7: 141,396,154 Y113C probably damaging Het
Tarbp1 A T 8: 126,447,594 probably null Het
Tars C T 15: 11,394,373 M59I probably benign Het
Tas2r130 G A 6: 131,630,817 T5I probably benign Het
Tex48 T C 4: 63,607,415 E77G probably damaging Het
Tmco5 A G 2: 116,892,255 R286G probably damaging Het
Trdmt1 A T 2: 13,519,914 H243Q probably benign Het
Ttn T A 2: 76,734,294 R26754* probably null Het
Ttn G A 2: 76,897,580 probably benign Het
Ubqln3 A C 7: 104,142,151 L244R probably damaging Het
Ubxn1 C T 19: 8,873,566 R115* probably null Het
Umod T G 7: 119,476,715 N276T probably damaging Het
Unc13c A T 9: 73,665,656 L1528Q probably damaging Het
Unc80 T A 1: 66,640,595 H2108Q possibly damaging Het
Utp4 A G 8: 106,898,521 Q144R probably benign Het
Vmn2r17 T A 5: 109,427,209 N127K probably benign Het
Vmn2r75 T A 7: 86,165,164 T374S probably benign Het
Washc5 A G 15: 59,350,408 F523L probably damaging Het
Wdr3 A T 3: 100,159,897 probably null Het
Wdr89 T C 12: 75,632,988 Y164C probably damaging Het
Xpo5 T C 17: 46,225,091 S550P probably damaging Het
Zfp69 T C 4: 120,930,832 T429A probably damaging Het
Zfpm1 G T 8: 122,336,592 G797C probably benign Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
Bell UTSW 10 88792625 missense probably benign 0.29
elite UTSW 10 88770808 missense probably benign
Margin UTSW 10 88768679 missense probably benign 0.04
Percentile UTSW 10 88775318 missense probably damaging 1.00
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7296:Utp20 UTSW 10 88770724 missense probably benign 0.21
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
R7330:Utp20 UTSW 10 88787562 frame shift probably null
R7367:Utp20 UTSW 10 88795443 missense probably benign 0.21
R7432:Utp20 UTSW 10 88798398 missense probably benign 0.00
R7447:Utp20 UTSW 10 88772492 missense probably damaging 1.00
R7473:Utp20 UTSW 10 88820710 splice site probably null
R7520:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R7530:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R7539:Utp20 UTSW 10 88791745 missense probably damaging 1.00
R7651:Utp20 UTSW 10 88754595 missense probably benign 0.41
R7728:Utp20 UTSW 10 88798341 missense probably damaging 1.00
R7831:Utp20 UTSW 10 88762770 nonsense probably null
R7833:Utp20 UTSW 10 88801136 missense possibly damaging 0.92
R7909:Utp20 UTSW 10 88775330 missense probably benign
R7956:Utp20 UTSW 10 88782614 missense probably benign 0.23
R7999:Utp20 UTSW 10 88770388 missense probably benign
R8080:Utp20 UTSW 10 88782715 missense possibly damaging 0.82
R8098:Utp20 UTSW 10 88752948 missense probably benign 0.13
R8104:Utp20 UTSW 10 88757904 missense probably damaging 1.00
R8129:Utp20 UTSW 10 88792625 missense probably benign 0.29
R8147:Utp20 UTSW 10 88758444 missense probably benign 0.02
R8199:Utp20 UTSW 10 88798475 missense probably benign
R8222:Utp20 UTSW 10 88778372 missense probably damaging 1.00
R8415:Utp20 UTSW 10 88826604 critical splice donor site probably null
R8466:Utp20 UTSW 10 88818503 missense probably damaging 1.00
R8505:Utp20 UTSW 10 88818008 missense probably benign 0.03
R8774:Utp20 UTSW 10 88752901 splice site probably benign
R8802:Utp20 UTSW 10 88747295 missense probably damaging 1.00
R8923:Utp20 UTSW 10 88791742 nonsense probably null
R8945:Utp20 UTSW 10 88792670 nonsense probably null
R9065:Utp20 UTSW 10 88757110 missense probably benign 0.32
R9092:Utp20 UTSW 10 88768817 missense probably benign
R9092:Utp20 UTSW 10 88775318 missense probably damaging 1.00
R9094:Utp20 UTSW 10 88775318 missense probably damaging 1.00
R9095:Utp20 UTSW 10 88775318 missense probably damaging 1.00
R9096:Utp20 UTSW 10 88775318 missense probably damaging 1.00
R9229:Utp20 UTSW 10 88758377 missense possibly damaging 0.86
R9323:Utp20 UTSW 10 88747308 missense probably damaging 1.00
R9336:Utp20 UTSW 10 88813936 missense probably damaging 1.00
R9467:Utp20 UTSW 10 88804528 missense possibly damaging 0.68
R9545:Utp20 UTSW 10 88782649 missense probably benign 0.38
RF005:Utp20 UTSW 10 88825457 missense probably damaging 1.00
RF024:Utp20 UTSW 10 88825457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAACAGCCCAAGGGTCTG -3'
(R):5'- AGCCAGAAATGCTGCCTATTAAC -3'

Sequencing Primer
(F):5'- CCAAGGGTCTGCCATGAC -3'
(R):5'- AAACATATTGCCCTTTCCTTTCAGAG -3'
Posted On 2014-09-17