Incidental Mutation 'R2060:Itsn2'
ID 228642
Institutional Source Beutler Lab
Gene Symbol Itsn2
Ensembl Gene ENSMUSG00000020640
Gene Name intersectin 2
Synonyms Sh3d1B, Sh3p18, Ese2, Eh domain, SH3 domain regulator of endocytosis 2
MMRRC Submission 040065-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2060 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 4642792-4763952 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 4677879 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 79 (F79V)
Ref Sequence ENSEMBL: ENSMUSP00000151663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062580] [ENSMUST00000218402] [ENSMUST00000219007] [ENSMUST00000220311]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000062580
AA Change: F79V
SMART Domains Protein: ENSMUSP00000052758
Gene: ENSMUSG00000020640
AA Change: F79V

DomainStartEndE-ValueType
EH 15 109 8.44e-41 SMART
EFh 58 86 7.18e-3 SMART
low complexity region 156 169 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
EH 238 333 4.06e-43 SMART
EFh 282 310 6.16e-2 SMART
coiled coil region 366 462 N/A INTRINSIC
coiled coil region 516 556 N/A INTRINSIC
coiled coil region 580 715 N/A INTRINSIC
SH3 721 778 2.65e-21 SMART
low complexity region 791 811 N/A INTRINSIC
SH3 855 909 8.83e-18 SMART
SH3 945 999 9.1e-20 SMART
SH3 1017 1077 1.55e-13 SMART
SH3 1091 1146 7.22e-23 SMART
RhoGEF 1174 1355 1.93e-56 SMART
PH 1396 1507 1.16e-9 SMART
C2 1531 1628 3.96e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218072
Predicted Effect probably damaging
Transcript: ENSMUST00000218402
AA Change: F79V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000219007
AA Change: F79V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219832
Predicted Effect unknown
Transcript: ENSMUST00000220311
AA Change: F79V
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains SH3 domains. This protein is a member of a family of proteins involved in clathrin-mediated endocytosis. Intersectin 2 is thought to regulate the formation of clathrin-coated vesicles and also may function in the induction of T cell antigen receptor (TCR) endocytosis. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal brain morphology and function and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 119,826,741 (GRCm39) W462* probably null Het
Aftph A T 11: 20,642,571 (GRCm39) Y821N probably damaging Het
Ahnak A T 19: 8,985,405 (GRCm39) M2230L probably benign Het
Arfgap1 T C 2: 180,614,575 (GRCm39) F144L probably benign Het
Arid4b C T 13: 14,370,037 (GRCm39) R1178C probably damaging Het
Asb8 A T 15: 98,039,254 (GRCm39) C49S possibly damaging Het
Baz1b A G 5: 135,233,968 (GRCm39) N165S probably damaging Het
Bod1l A T 5: 41,966,085 (GRCm39) I2660N possibly damaging Het
C2cd3 T C 7: 100,104,155 (GRCm39) I825T probably damaging Het
C4b A G 17: 34,955,075 (GRCm39) W804R probably damaging Het
Cadm3 A T 1: 173,171,969 (GRCm39) D201E probably damaging Het
Cdh17 T C 4: 11,803,982 (GRCm39) F552L probably benign Het
Cdh20 G C 1: 109,976,607 (GRCm39) A91P probably damaging Het
Cela1 A G 15: 100,573,203 (GRCm39) probably null Het
Clk3 T C 9: 57,658,400 (GRCm39) Y582C probably damaging Het
Cma1 C T 14: 56,181,155 (GRCm39) probably null Het
Ctcfl A G 2: 172,960,299 (GRCm39) S95P probably benign Het
Cylc1 C A X: 110,166,892 (GRCm39) T391K unknown Het
Cyp3a11 T A 5: 145,791,891 (GRCm39) I501L probably benign Het
Cyp3a59 T A 5: 146,041,524 (GRCm39) L356Q probably damaging Het
Dcdc2a A C 13: 25,291,693 (GRCm39) D226A possibly damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dlec1 A C 9: 118,941,154 (GRCm39) T235P probably damaging Het
Dnaaf1 G A 8: 120,317,341 (GRCm39) R290Q probably benign Het
Dnaaf5 C T 5: 139,163,758 (GRCm39) R377W probably damaging Het
Dpep1 T A 8: 123,927,130 (GRCm39) V293E probably damaging Het
Drosha T A 15: 12,924,245 (GRCm39) V1209E possibly damaging Het
Dync2h1 T G 9: 7,162,802 (GRCm39) I596L possibly damaging Het
Edem1 T A 6: 108,831,248 (GRCm39) Y570N probably damaging Het
Edrf1 G T 7: 133,258,858 (GRCm39) E9* probably null Het
Enpep T A 3: 129,074,172 (GRCm39) N792Y probably benign Het
Enpp2 A T 15: 54,739,110 (GRCm39) M391K probably damaging Het
Fanca A C 8: 124,001,220 (GRCm39) V1105G probably damaging Het
Fbxo22 T A 9: 55,125,667 (GRCm39) L74I probably damaging Het
Fchsd2 T A 7: 100,926,624 (GRCm39) F571L probably benign Het
Fhad1 T C 4: 141,626,560 (GRCm39) D1345G probably benign Het
G2e3 T C 12: 51,419,389 (GRCm39) F702L probably damaging Het
Glce A T 9: 61,968,228 (GRCm39) S308T possibly damaging Het
Glt1d1 A G 5: 127,734,183 (GRCm39) D119G probably benign Het
Gpr137c T C 14: 45,481,616 (GRCm39) I144T probably damaging Het
Gprin3 A G 6: 59,331,504 (GRCm39) C268R possibly damaging Het
Hadha G A 5: 30,333,834 (GRCm39) T395M probably benign Het
Hdhd2 T G 18: 77,052,738 (GRCm39) probably null Het
Homer2 C T 7: 81,268,451 (GRCm39) E70K probably benign Het
Hp1bp3 T A 4: 137,967,983 (GRCm39) D397E probably damaging Het
Hrh3 T C 2: 179,743,043 (GRCm39) N195S possibly damaging Het
Hyou1 T C 9: 44,292,849 (GRCm39) V153A probably benign Het
Igf2r A T 17: 12,920,206 (GRCm39) S1378T possibly damaging Het
Ints4 G A 7: 97,150,970 (GRCm39) R279H possibly damaging Het
Itga10 A T 3: 96,562,314 (GRCm39) R699* probably null Het
Itpkb A G 1: 180,249,423 (GRCm39) T933A probably benign Het
Jak3 C A 8: 72,133,358 (GRCm39) C350* probably null Het
Jak3 A T 8: 72,136,059 (GRCm39) K620* probably null Het
Kcnq5 T C 1: 21,531,821 (GRCm39) S421G probably benign Het
Kdm2b A T 5: 123,021,428 (GRCm39) M50K probably damaging Het
Klk1b1 A G 7: 43,620,047 (GRCm39) D170G possibly damaging Het
Lama3 A T 18: 12,661,783 (GRCm39) T2160S probably benign Het
Lman1 A T 18: 66,131,423 (GRCm39) probably benign Het
Lmtk3 G A 7: 45,450,335 (GRCm39) probably null Het
Ltb A G 17: 35,414,739 (GRCm39) R180G probably damaging Het
Ltbp4 C T 7: 27,008,378 (GRCm39) R1310Q probably damaging Het
Macf1 T A 4: 123,393,712 (GRCm39) probably null Het
Mast4 G T 13: 102,875,354 (GRCm39) P1146Q probably damaging Het
Micall2 C T 5: 139,697,317 (GRCm39) S678N probably damaging Het
Mon2 A T 10: 122,831,681 (GRCm39) I1675N probably damaging Het
Mug2 A G 6: 122,056,571 (GRCm39) N1172S probably benign Het
Naa30 C G 14: 49,410,556 (GRCm39) S161R possibly damaging Het
Ncaph T C 2: 126,966,795 (GRCm39) N220D probably damaging Het
Nell1 T C 7: 50,210,578 (GRCm39) V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 (GRCm38) N142S possibly damaging Het
Nin T A 12: 70,089,192 (GRCm39) T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 (GRCm38) noncoding transcript Het
Nrg1 T G 8: 32,408,043 (GRCm39) E63D probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or14j7 A G 17: 38,234,771 (GRCm39) T105A probably benign Het
Or5d39 T C 2: 87,979,487 (GRCm39) Y292C probably damaging Het
Or5g29 G A 2: 85,421,627 (GRCm39) V248I possibly damaging Het
Or5p53 C T 7: 107,532,868 (GRCm39) T47M probably benign Het
Or6ae1 T A 7: 139,742,737 (GRCm39) E42V probably damaging Het
Or7d11 A T 9: 19,965,892 (GRCm39) I289N probably damaging Het
Or7g27 A G 9: 19,250,352 (GRCm39) I199V probably benign Het
Or7g32 T A 9: 19,408,533 (GRCm39) V163E possibly damaging Het
Orc5 C T 5: 22,721,701 (GRCm39) probably null Het
Pard3 G A 8: 128,125,085 (GRCm39) R691Q probably benign Het
Pofut1 T A 2: 153,085,580 (GRCm39) D54E probably benign Het
Prl2c5 T A 13: 13,365,238 (GRCm39) V128E probably damaging Het
Ptk7 T C 17: 46,877,164 (GRCm39) M965V possibly damaging Het
Pum2 C T 12: 8,778,726 (GRCm39) R459* probably null Het
Pzp A T 6: 128,460,673 (GRCm39) N1494K probably benign Het
Rad21l A G 2: 151,487,349 (GRCm39) V545A probably benign Het
Rps6kc1 A T 1: 190,542,305 (GRCm39) M352K possibly damaging Het
Rpusd2 G A 2: 118,867,696 (GRCm39) probably null Het
Rsph14 A T 10: 74,865,603 (GRCm39) D78E probably damaging Het
Rtl9 A T X: 141,885,026 (GRCm39) M813L possibly damaging Het
Rtp4 A T 16: 23,431,690 (GRCm39) H74L probably damaging Het
Rusc1 G A 3: 88,995,155 (GRCm39) T725I possibly damaging Het
Rusf1 A G 7: 127,887,503 (GRCm39) L176P probably damaging Het
Ryr2 C T 13: 11,610,622 (GRCm39) C4068Y probably damaging Het
Ryr3 A G 2: 112,784,709 (GRCm39) V224A possibly damaging Het
Shprh A T 10: 11,027,864 (GRCm39) N157I probably benign Het
Siglece A G 7: 43,307,210 (GRCm39) I67T probably benign Het
Slc9b2 A T 3: 135,032,027 (GRCm39) T296S probably damaging Het
Sorbs2 A G 8: 46,228,666 (GRCm39) K276E probably damaging Het
Synj2 A G 17: 6,087,755 (GRCm39) T1269A probably benign Het
Taar7b T C 10: 23,876,573 (GRCm39) I246T possibly damaging Het
Taldo1 A G 7: 140,976,067 (GRCm39) Y113C probably damaging Het
Tarbp1 A T 8: 127,174,333 (GRCm39) probably null Het
Tars1 C T 15: 11,394,459 (GRCm39) M59I probably benign Het
Tas2r130 G A 6: 131,607,780 (GRCm39) T5I probably benign Het
Tex48 T C 4: 63,525,652 (GRCm39) E77G probably damaging Het
Tmco5 A G 2: 116,722,736 (GRCm39) R286G probably damaging Het
Trdmt1 A T 2: 13,524,725 (GRCm39) H243Q probably benign Het
Ttn T A 2: 76,564,638 (GRCm39) R26754* probably null Het
Ttn G A 2: 76,727,924 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,791,358 (GRCm39) L244R probably damaging Het
Ubxn1 C T 19: 8,850,930 (GRCm39) R115* probably null Het
Umod T G 7: 119,075,938 (GRCm39) N276T probably damaging Het
Unc13c A T 9: 73,572,938 (GRCm39) L1528Q probably damaging Het
Unc80 T A 1: 66,679,754 (GRCm39) H2108Q possibly damaging Het
Utp20 A C 10: 88,610,657 (GRCm39) D1442E probably damaging Het
Utp4 A G 8: 107,625,153 (GRCm39) Q144R probably benign Het
Vmn2r17 T A 5: 109,575,075 (GRCm39) N127K probably benign Het
Vmn2r75 T A 7: 85,814,372 (GRCm39) T374S probably benign Het
Washc5 A G 15: 59,222,257 (GRCm39) F523L probably damaging Het
Wdr3 A T 3: 100,067,213 (GRCm39) probably null Het
Wdr89 T C 12: 75,679,762 (GRCm39) Y164C probably damaging Het
Xpo5 T C 17: 46,536,017 (GRCm39) S550P probably damaging Het
Zfp69 T C 4: 120,788,029 (GRCm39) T429A probably damaging Het
Zfpm1 G T 8: 123,063,331 (GRCm39) G797C probably benign Het
Other mutations in Itsn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Itsn2 APN 12 4,708,027 (GRCm39) missense possibly damaging 0.95
IGL00647:Itsn2 APN 12 4,663,311 (GRCm39) splice site probably benign
IGL00933:Itsn2 APN 12 4,757,540 (GRCm39) missense probably damaging 1.00
IGL01686:Itsn2 APN 12 4,686,693 (GRCm39) splice site probably benign
IGL01873:Itsn2 APN 12 4,682,366 (GRCm39) splice site probably benign
IGL02200:Itsn2 APN 12 4,686,632 (GRCm39) missense probably damaging 0.98
IGL02280:Itsn2 APN 12 4,758,961 (GRCm39) missense possibly damaging 0.89
IGL02388:Itsn2 APN 12 4,679,557 (GRCm39) missense possibly damaging 0.91
IGL02938:Itsn2 APN 12 4,747,216 (GRCm39) missense probably damaging 0.98
Gopher UTSW 12 4,756,983 (GRCm39) nonsense probably null
inversus UTSW 12 4,689,670 (GRCm39) nonsense probably null
Liberator UTSW 12 4,716,176 (GRCm39) nonsense probably null
rolled UTSW 12 4,684,792 (GRCm39) nonsense probably null
Stratofortress UTSW 12 4,674,927 (GRCm39) missense probably damaging 1.00
Underground UTSW 12 4,751,276 (GRCm39) missense probably damaging 1.00
Vole UTSW 12 4,723,420 (GRCm39) nonsense probably null
R0101:Itsn2 UTSW 12 4,683,058 (GRCm39) unclassified probably benign
R0268:Itsn2 UTSW 12 4,750,333 (GRCm39) missense probably benign 0.12
R0584:Itsn2 UTSW 12 4,747,180 (GRCm39) missense probably benign
R0604:Itsn2 UTSW 12 4,708,189 (GRCm39) missense probably benign 0.01
R0639:Itsn2 UTSW 12 4,762,556 (GRCm39) missense probably damaging 0.99
R0738:Itsn2 UTSW 12 4,685,681 (GRCm39) missense probably benign 0.17
R1132:Itsn2 UTSW 12 4,708,464 (GRCm39) missense probably damaging 1.00
R1163:Itsn2 UTSW 12 4,762,009 (GRCm39) missense probably benign 0.30
R1169:Itsn2 UTSW 12 4,689,694 (GRCm39) missense probably damaging 1.00
R1258:Itsn2 UTSW 12 4,723,464 (GRCm39) missense probably damaging 1.00
R1297:Itsn2 UTSW 12 4,750,378 (GRCm39) missense probably damaging 1.00
R1423:Itsn2 UTSW 12 4,723,572 (GRCm39) missense probably damaging 0.97
R1572:Itsn2 UTSW 12 4,700,044 (GRCm39) missense probably benign 0.03
R1601:Itsn2 UTSW 12 4,708,452 (GRCm39) missense probably benign 0.01
R1628:Itsn2 UTSW 12 4,679,652 (GRCm39) missense probably benign
R1650:Itsn2 UTSW 12 4,687,767 (GRCm39) missense probably damaging 0.97
R1752:Itsn2 UTSW 12 4,761,950 (GRCm39) splice site probably null
R1758:Itsn2 UTSW 12 4,708,160 (GRCm39) missense possibly damaging 0.83
R1942:Itsn2 UTSW 12 4,689,670 (GRCm39) nonsense probably null
R1976:Itsn2 UTSW 12 4,722,733 (GRCm39) splice site probably benign
R2000:Itsn2 UTSW 12 4,716,176 (GRCm39) nonsense probably null
R2119:Itsn2 UTSW 12 4,757,025 (GRCm39) missense probably benign 0.32
R2168:Itsn2 UTSW 12 4,683,044 (GRCm39) unclassified probably benign
R2394:Itsn2 UTSW 12 4,757,005 (GRCm39) missense possibly damaging 0.86
R2860:Itsn2 UTSW 12 4,750,315 (GRCm39) splice site probably benign
R2861:Itsn2 UTSW 12 4,750,315 (GRCm39) splice site probably benign
R2900:Itsn2 UTSW 12 4,680,713 (GRCm39) unclassified probably benign
R2991:Itsn2 UTSW 12 4,708,474 (GRCm39) missense probably benign 0.01
R3087:Itsn2 UTSW 12 4,716,303 (GRCm39) missense probably damaging 1.00
R3881:Itsn2 UTSW 12 4,684,546 (GRCm39) unclassified probably benign
R4022:Itsn2 UTSW 12 4,674,927 (GRCm39) missense probably damaging 1.00
R4332:Itsn2 UTSW 12 4,762,611 (GRCm39) missense possibly damaging 0.72
R4657:Itsn2 UTSW 12 4,763,197 (GRCm39) makesense probably null
R4727:Itsn2 UTSW 12 4,757,660 (GRCm39) missense probably damaging 0.99
R4745:Itsn2 UTSW 12 4,711,944 (GRCm39) missense probably damaging 1.00
R4770:Itsn2 UTSW 12 4,677,892 (GRCm39) missense probably damaging 1.00
R4905:Itsn2 UTSW 12 4,684,583 (GRCm39) unclassified probably benign
R5269:Itsn2 UTSW 12 4,683,553 (GRCm39) unclassified probably benign
R5314:Itsn2 UTSW 12 4,677,960 (GRCm39) missense probably benign 0.09
R5345:Itsn2 UTSW 12 4,722,783 (GRCm39) missense probably damaging 1.00
R5399:Itsn2 UTSW 12 4,703,535 (GRCm39) missense probably benign 0.22
R5566:Itsn2 UTSW 12 4,676,554 (GRCm39) missense probably damaging 1.00
R5725:Itsn2 UTSW 12 4,680,767 (GRCm39) unclassified probably benign
R5773:Itsn2 UTSW 12 4,757,089 (GRCm39) missense probably damaging 1.00
R6116:Itsn2 UTSW 12 4,679,939 (GRCm39) unclassified probably benign
R6254:Itsn2 UTSW 12 4,674,982 (GRCm39) splice site probably null
R6325:Itsn2 UTSW 12 4,756,351 (GRCm39) missense probably damaging 1.00
R6361:Itsn2 UTSW 12 4,679,655 (GRCm39) missense probably benign 0.18
R6456:Itsn2 UTSW 12 4,679,923 (GRCm39) unclassified probably benign
R6494:Itsn2 UTSW 12 4,684,792 (GRCm39) nonsense probably null
R6854:Itsn2 UTSW 12 4,702,382 (GRCm39) missense probably benign 0.37
R6941:Itsn2 UTSW 12 4,679,641 (GRCm39) missense probably benign 0.05
R6961:Itsn2 UTSW 12 4,723,420 (GRCm39) nonsense probably null
R7326:Itsn2 UTSW 12 4,682,985 (GRCm39) missense unknown
R7387:Itsn2 UTSW 12 4,689,781 (GRCm39) missense probably damaging 1.00
R7465:Itsn2 UTSW 12 4,756,983 (GRCm39) nonsense probably null
R7471:Itsn2 UTSW 12 4,758,198 (GRCm39) missense probably benign 0.43
R7814:Itsn2 UTSW 12 4,708,561 (GRCm39) missense probably benign 0.14
R7854:Itsn2 UTSW 12 4,751,276 (GRCm39) missense probably damaging 1.00
R7879:Itsn2 UTSW 12 4,751,265 (GRCm39) missense probably benign 0.16
R7990:Itsn2 UTSW 12 4,685,629 (GRCm39) missense unknown
R8009:Itsn2 UTSW 12 4,714,553 (GRCm39) missense probably benign 0.12
R8115:Itsn2 UTSW 12 4,723,602 (GRCm39) missense possibly damaging 0.90
R8143:Itsn2 UTSW 12 4,683,003 (GRCm39) missense unknown
R8248:Itsn2 UTSW 12 4,712,052 (GRCm39) missense probably benign 0.00
R8735:Itsn2 UTSW 12 4,721,474 (GRCm39) missense probably damaging 1.00
R8748:Itsn2 UTSW 12 4,751,337 (GRCm39) missense probably benign 0.36
R9018:Itsn2 UTSW 12 4,708,091 (GRCm39) missense possibly damaging 0.57
R9386:Itsn2 UTSW 12 4,679,730 (GRCm39) missense unknown
R9681:Itsn2 UTSW 12 4,683,499 (GRCm39) missense unknown
Z1088:Itsn2 UTSW 12 4,762,472 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCTGGCTAGTATTTCTCACTGTT -3'
(R):5'- TAACTGTGACAGGAGATTCAGGC -3'

Sequencing Primer
(F):5'- TTCTGTTATTCATACACACACACAC -3'
(R):5'- CCAGACAGGGACACTTAGCTATG -3'
Posted On 2014-09-17