Incidental Mutation 'R2060:Pum2'
ID 228643
Institutional Source Beutler Lab
Gene Symbol Pum2
Ensembl Gene ENSMUSG00000020594
Gene Name pumilio RNA-binding family member 2
Synonyms Pumm2, 5730503J23Rik
MMRRC Submission 040065-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2060 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 8724134-8802581 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 8778726 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 459 (R459*)
Ref Sequence ENSEMBL: ENSMUSP00000137020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020915] [ENSMUST00000111122] [ENSMUST00000111123] [ENSMUST00000163569] [ENSMUST00000165293] [ENSMUST00000168361] [ENSMUST00000169089] [ENSMUST00000178015]
AlphaFold Q80U58
Predicted Effect probably null
Transcript: ENSMUST00000020915
AA Change: R454*
SMART Domains Protein: ENSMUSP00000020915
Gene: ENSMUSG00000020594
AA Change: R454*

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 319 336 N/A INTRINSIC
low complexity region 353 378 N/A INTRINSIC
low complexity region 464 490 N/A INTRINSIC
low complexity region 498 509 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 542 576 N/A INTRINSIC
low complexity region 591 609 N/A INTRINSIC
Pumilio 642 677 2.35e-7 SMART
Pumilio 678 713 6.54e-6 SMART
Pumilio 714 749 2.89e-7 SMART
Pumilio 750 785 3.37e-8 SMART
Pumilio 786 821 4.84e-9 SMART
Pumilio 822 857 3.2e-9 SMART
Pumilio 858 893 5.78e-7 SMART
Pumilio 901 936 3.62e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111122
AA Change: R459*
SMART Domains Protein: ENSMUSP00000106751
Gene: ENSMUSG00000020594
AA Change: R459*

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 833 2.89e-7 SMART
Pumilio 834 869 3.37e-8 SMART
Pumilio 870 905 4.84e-9 SMART
Pumilio 906 941 3.2e-9 SMART
Pumilio 942 977 5.78e-7 SMART
Pumilio 985 1020 3.62e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111123
AA Change: R459*
SMART Domains Protein: ENSMUSP00000106752
Gene: ENSMUSG00000020594
AA Change: R459*

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 833 2.89e-7 SMART
Pumilio 834 869 3.37e-8 SMART
Pumilio 870 905 4.84e-9 SMART
Pumilio 906 941 3.2e-9 SMART
Pumilio 942 977 5.78e-7 SMART
Pumilio 985 1020 3.62e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163569
AA Change: R459*
SMART Domains Protein: ENSMUSP00000131074
Gene: ENSMUSG00000020594
AA Change: R459*

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 832 1.29e-4 SMART
Pumilio 836 871 3.37e-8 SMART
Pumilio 872 907 4.84e-9 SMART
Pumilio 908 943 3.2e-9 SMART
Pumilio 944 979 5.78e-7 SMART
Pumilio 987 1022 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164818
SMART Domains Protein: ENSMUSP00000129243
Gene: ENSMUSG00000020594

DomainStartEndE-ValueType
low complexity region 24 42 N/A INTRINSIC
Pumilio 75 110 2.35e-7 SMART
Pumilio 111 139 1.58e1 SMART
Pumilio 140 175 3.37e-8 SMART
Pumilio 176 211 4.84e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165293
Predicted Effect probably null
Transcript: ENSMUST00000168361
AA Change: R459*
SMART Domains Protein: ENSMUSP00000128292
Gene: ENSMUSG00000020594
AA Change: R459*

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 832 1.29e-4 SMART
Pumilio 836 871 3.37e-8 SMART
Pumilio 872 907 4.84e-9 SMART
Pumilio 908 943 3.2e-9 SMART
Pumilio 944 979 5.78e-7 SMART
Pumilio 987 1022 3.62e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169089
AA Change: R459*
SMART Domains Protein: ENSMUSP00000132122
Gene: ENSMUSG00000020594
AA Change: R459*

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 581 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
Pumilio 647 682 2.35e-7 SMART
Pumilio 683 718 6.54e-6 SMART
Pumilio 719 754 2.89e-7 SMART
Pumilio 755 790 3.37e-8 SMART
Pumilio 791 826 4.84e-9 SMART
Pumilio 827 862 3.2e-9 SMART
Pumilio 863 898 5.78e-7 SMART
Pumilio 906 941 3.62e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000178015
AA Change: R459*
SMART Domains Protein: ENSMUSP00000137020
Gene: ENSMUSG00000020594
AA Change: R459*

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 581 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
Pumilio 647 682 2.35e-7 SMART
Pumilio 683 718 6.54e-6 SMART
Pumilio 719 754 2.89e-7 SMART
Pumilio 755 790 3.37e-8 SMART
Pumilio 791 826 4.84e-9 SMART
Pumilio 827 862 3.2e-9 SMART
Pumilio 863 898 5.78e-7 SMART
Pumilio 906 941 3.62e-8 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of RNA-binding proteins. The encoded protein functions as a translational repressor during embryonic development and cell differentiation. This protein is also thought to be a positive regulator of cell proliferation in adipose-derived stem cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit significantly smaller testes and seminiferous tubule degeneration but are otherwise viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 119,826,741 (GRCm39) W462* probably null Het
Aftph A T 11: 20,642,571 (GRCm39) Y821N probably damaging Het
Ahnak A T 19: 8,985,405 (GRCm39) M2230L probably benign Het
Arfgap1 T C 2: 180,614,575 (GRCm39) F144L probably benign Het
Arid4b C T 13: 14,370,037 (GRCm39) R1178C probably damaging Het
Asb8 A T 15: 98,039,254 (GRCm39) C49S possibly damaging Het
Baz1b A G 5: 135,233,968 (GRCm39) N165S probably damaging Het
Bod1l A T 5: 41,966,085 (GRCm39) I2660N possibly damaging Het
C2cd3 T C 7: 100,104,155 (GRCm39) I825T probably damaging Het
C4b A G 17: 34,955,075 (GRCm39) W804R probably damaging Het
Cadm3 A T 1: 173,171,969 (GRCm39) D201E probably damaging Het
Cdh17 T C 4: 11,803,982 (GRCm39) F552L probably benign Het
Cdh20 G C 1: 109,976,607 (GRCm39) A91P probably damaging Het
Cela1 A G 15: 100,573,203 (GRCm39) probably null Het
Clk3 T C 9: 57,658,400 (GRCm39) Y582C probably damaging Het
Cma1 C T 14: 56,181,155 (GRCm39) probably null Het
Ctcfl A G 2: 172,960,299 (GRCm39) S95P probably benign Het
Cylc1 C A X: 110,166,892 (GRCm39) T391K unknown Het
Cyp3a11 T A 5: 145,791,891 (GRCm39) I501L probably benign Het
Cyp3a59 T A 5: 146,041,524 (GRCm39) L356Q probably damaging Het
Dcdc2a A C 13: 25,291,693 (GRCm39) D226A possibly damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dlec1 A C 9: 118,941,154 (GRCm39) T235P probably damaging Het
Dnaaf1 G A 8: 120,317,341 (GRCm39) R290Q probably benign Het
Dnaaf5 C T 5: 139,163,758 (GRCm39) R377W probably damaging Het
Dpep1 T A 8: 123,927,130 (GRCm39) V293E probably damaging Het
Drosha T A 15: 12,924,245 (GRCm39) V1209E possibly damaging Het
Dync2h1 T G 9: 7,162,802 (GRCm39) I596L possibly damaging Het
Edem1 T A 6: 108,831,248 (GRCm39) Y570N probably damaging Het
Edrf1 G T 7: 133,258,858 (GRCm39) E9* probably null Het
Enpep T A 3: 129,074,172 (GRCm39) N792Y probably benign Het
Enpp2 A T 15: 54,739,110 (GRCm39) M391K probably damaging Het
Fanca A C 8: 124,001,220 (GRCm39) V1105G probably damaging Het
Fbxo22 T A 9: 55,125,667 (GRCm39) L74I probably damaging Het
Fchsd2 T A 7: 100,926,624 (GRCm39) F571L probably benign Het
Fhad1 T C 4: 141,626,560 (GRCm39) D1345G probably benign Het
G2e3 T C 12: 51,419,389 (GRCm39) F702L probably damaging Het
Glce A T 9: 61,968,228 (GRCm39) S308T possibly damaging Het
Glt1d1 A G 5: 127,734,183 (GRCm39) D119G probably benign Het
Gpr137c T C 14: 45,481,616 (GRCm39) I144T probably damaging Het
Gprin3 A G 6: 59,331,504 (GRCm39) C268R possibly damaging Het
Hadha G A 5: 30,333,834 (GRCm39) T395M probably benign Het
Hdhd2 T G 18: 77,052,738 (GRCm39) probably null Het
Homer2 C T 7: 81,268,451 (GRCm39) E70K probably benign Het
Hp1bp3 T A 4: 137,967,983 (GRCm39) D397E probably damaging Het
Hrh3 T C 2: 179,743,043 (GRCm39) N195S possibly damaging Het
Hyou1 T C 9: 44,292,849 (GRCm39) V153A probably benign Het
Igf2r A T 17: 12,920,206 (GRCm39) S1378T possibly damaging Het
Ints4 G A 7: 97,150,970 (GRCm39) R279H possibly damaging Het
Itga10 A T 3: 96,562,314 (GRCm39) R699* probably null Het
Itpkb A G 1: 180,249,423 (GRCm39) T933A probably benign Het
Itsn2 T G 12: 4,677,879 (GRCm39) F79V probably damaging Het
Jak3 C A 8: 72,133,358 (GRCm39) C350* probably null Het
Jak3 A T 8: 72,136,059 (GRCm39) K620* probably null Het
Kcnq5 T C 1: 21,531,821 (GRCm39) S421G probably benign Het
Kdm2b A T 5: 123,021,428 (GRCm39) M50K probably damaging Het
Klk1b1 A G 7: 43,620,047 (GRCm39) D170G possibly damaging Het
Lama3 A T 18: 12,661,783 (GRCm39) T2160S probably benign Het
Lman1 A T 18: 66,131,423 (GRCm39) probably benign Het
Lmtk3 G A 7: 45,450,335 (GRCm39) probably null Het
Ltb A G 17: 35,414,739 (GRCm39) R180G probably damaging Het
Ltbp4 C T 7: 27,008,378 (GRCm39) R1310Q probably damaging Het
Macf1 T A 4: 123,393,712 (GRCm39) probably null Het
Mast4 G T 13: 102,875,354 (GRCm39) P1146Q probably damaging Het
Micall2 C T 5: 139,697,317 (GRCm39) S678N probably damaging Het
Mon2 A T 10: 122,831,681 (GRCm39) I1675N probably damaging Het
Mug2 A G 6: 122,056,571 (GRCm39) N1172S probably benign Het
Naa30 C G 14: 49,410,556 (GRCm39) S161R possibly damaging Het
Ncaph T C 2: 126,966,795 (GRCm39) N220D probably damaging Het
Nell1 T C 7: 50,210,578 (GRCm39) V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 (GRCm38) N142S possibly damaging Het
Nin T A 12: 70,089,192 (GRCm39) T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 (GRCm38) noncoding transcript Het
Nrg1 T G 8: 32,408,043 (GRCm39) E63D probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or14j7 A G 17: 38,234,771 (GRCm39) T105A probably benign Het
Or5d39 T C 2: 87,979,487 (GRCm39) Y292C probably damaging Het
Or5g29 G A 2: 85,421,627 (GRCm39) V248I possibly damaging Het
Or5p53 C T 7: 107,532,868 (GRCm39) T47M probably benign Het
Or6ae1 T A 7: 139,742,737 (GRCm39) E42V probably damaging Het
Or7d11 A T 9: 19,965,892 (GRCm39) I289N probably damaging Het
Or7g27 A G 9: 19,250,352 (GRCm39) I199V probably benign Het
Or7g32 T A 9: 19,408,533 (GRCm39) V163E possibly damaging Het
Orc5 C T 5: 22,721,701 (GRCm39) probably null Het
Pard3 G A 8: 128,125,085 (GRCm39) R691Q probably benign Het
Pofut1 T A 2: 153,085,580 (GRCm39) D54E probably benign Het
Prl2c5 T A 13: 13,365,238 (GRCm39) V128E probably damaging Het
Ptk7 T C 17: 46,877,164 (GRCm39) M965V possibly damaging Het
Pzp A T 6: 128,460,673 (GRCm39) N1494K probably benign Het
Rad21l A G 2: 151,487,349 (GRCm39) V545A probably benign Het
Rps6kc1 A T 1: 190,542,305 (GRCm39) M352K possibly damaging Het
Rpusd2 G A 2: 118,867,696 (GRCm39) probably null Het
Rsph14 A T 10: 74,865,603 (GRCm39) D78E probably damaging Het
Rtl9 A T X: 141,885,026 (GRCm39) M813L possibly damaging Het
Rtp4 A T 16: 23,431,690 (GRCm39) H74L probably damaging Het
Rusc1 G A 3: 88,995,155 (GRCm39) T725I possibly damaging Het
Rusf1 A G 7: 127,887,503 (GRCm39) L176P probably damaging Het
Ryr2 C T 13: 11,610,622 (GRCm39) C4068Y probably damaging Het
Ryr3 A G 2: 112,784,709 (GRCm39) V224A possibly damaging Het
Shprh A T 10: 11,027,864 (GRCm39) N157I probably benign Het
Siglece A G 7: 43,307,210 (GRCm39) I67T probably benign Het
Slc9b2 A T 3: 135,032,027 (GRCm39) T296S probably damaging Het
Sorbs2 A G 8: 46,228,666 (GRCm39) K276E probably damaging Het
Synj2 A G 17: 6,087,755 (GRCm39) T1269A probably benign Het
Taar7b T C 10: 23,876,573 (GRCm39) I246T possibly damaging Het
Taldo1 A G 7: 140,976,067 (GRCm39) Y113C probably damaging Het
Tarbp1 A T 8: 127,174,333 (GRCm39) probably null Het
Tars1 C T 15: 11,394,459 (GRCm39) M59I probably benign Het
Tas2r130 G A 6: 131,607,780 (GRCm39) T5I probably benign Het
Tex48 T C 4: 63,525,652 (GRCm39) E77G probably damaging Het
Tmco5 A G 2: 116,722,736 (GRCm39) R286G probably damaging Het
Trdmt1 A T 2: 13,524,725 (GRCm39) H243Q probably benign Het
Ttn T A 2: 76,564,638 (GRCm39) R26754* probably null Het
Ttn G A 2: 76,727,924 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,791,358 (GRCm39) L244R probably damaging Het
Ubxn1 C T 19: 8,850,930 (GRCm39) R115* probably null Het
Umod T G 7: 119,075,938 (GRCm39) N276T probably damaging Het
Unc13c A T 9: 73,572,938 (GRCm39) L1528Q probably damaging Het
Unc80 T A 1: 66,679,754 (GRCm39) H2108Q possibly damaging Het
Utp20 A C 10: 88,610,657 (GRCm39) D1442E probably damaging Het
Utp4 A G 8: 107,625,153 (GRCm39) Q144R probably benign Het
Vmn2r17 T A 5: 109,575,075 (GRCm39) N127K probably benign Het
Vmn2r75 T A 7: 85,814,372 (GRCm39) T374S probably benign Het
Washc5 A G 15: 59,222,257 (GRCm39) F523L probably damaging Het
Wdr3 A T 3: 100,067,213 (GRCm39) probably null Het
Wdr89 T C 12: 75,679,762 (GRCm39) Y164C probably damaging Het
Xpo5 T C 17: 46,536,017 (GRCm39) S550P probably damaging Het
Zfp69 T C 4: 120,788,029 (GRCm39) T429A probably damaging Het
Zfpm1 G T 8: 123,063,331 (GRCm39) G797C probably benign Het
Other mutations in Pum2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Pum2 APN 12 8,783,381 (GRCm39) missense probably damaging 1.00
IGL02118:Pum2 APN 12 8,779,117 (GRCm39) missense probably benign 0.31
IGL02185:Pum2 APN 12 8,798,955 (GRCm39) critical splice donor site probably null
IGL02528:Pum2 APN 12 8,778,696 (GRCm39) nonsense probably null
IGL02718:Pum2 APN 12 8,783,344 (GRCm39) missense probably benign 0.02
Plumbat UTSW 12 8,778,779 (GRCm39) critical splice donor site probably null
Pummie UTSW 12 8,763,906 (GRCm39) nonsense probably null
Yorkshire UTSW 12 8,778,726 (GRCm39) nonsense probably null
PIT4366001:Pum2 UTSW 12 8,783,390 (GRCm39) missense probably damaging 1.00
R0152:Pum2 UTSW 12 8,778,754 (GRCm39) missense possibly damaging 0.94
R0317:Pum2 UTSW 12 8,778,754 (GRCm39) missense possibly damaging 0.94
R0357:Pum2 UTSW 12 8,771,785 (GRCm39) missense possibly damaging 0.92
R0413:Pum2 UTSW 12 8,763,464 (GRCm39) missense probably benign 0.00
R0494:Pum2 UTSW 12 8,771,736 (GRCm39) nonsense probably null
R0520:Pum2 UTSW 12 8,771,710 (GRCm39) missense probably damaging 1.00
R0727:Pum2 UTSW 12 8,794,465 (GRCm39) missense probably damaging 1.00
R1576:Pum2 UTSW 12 8,763,524 (GRCm39) missense probably benign 0.01
R2035:Pum2 UTSW 12 8,778,638 (GRCm39) nonsense probably null
R2422:Pum2 UTSW 12 8,798,931 (GRCm39) missense possibly damaging 0.70
R2437:Pum2 UTSW 12 8,794,654 (GRCm39) missense probably benign 0.19
R3767:Pum2 UTSW 12 8,769,076 (GRCm39) nonsense probably null
R4715:Pum2 UTSW 12 8,797,272 (GRCm39) missense probably damaging 1.00
R5155:Pum2 UTSW 12 8,763,572 (GRCm39) missense possibly damaging 0.79
R5226:Pum2 UTSW 12 8,763,458 (GRCm39) missense possibly damaging 0.73
R5323:Pum2 UTSW 12 8,794,706 (GRCm39) missense probably damaging 1.00
R6250:Pum2 UTSW 12 8,794,755 (GRCm39) splice site probably null
R6253:Pum2 UTSW 12 8,798,205 (GRCm39) missense probably damaging 1.00
R6508:Pum2 UTSW 12 8,798,861 (GRCm39) missense probably benign 0.17
R6953:Pum2 UTSW 12 8,778,779 (GRCm39) critical splice donor site probably null
R7135:Pum2 UTSW 12 8,778,952 (GRCm39) missense possibly damaging 0.80
R7355:Pum2 UTSW 12 8,763,906 (GRCm39) nonsense probably null
R7586:Pum2 UTSW 12 8,797,206 (GRCm39) missense probably damaging 1.00
R7683:Pum2 UTSW 12 8,778,922 (GRCm39) missense possibly damaging 0.93
R7869:Pum2 UTSW 12 8,763,595 (GRCm39) missense probably benign 0.00
R7873:Pum2 UTSW 12 8,798,802 (GRCm39) missense possibly damaging 0.94
R7980:Pum2 UTSW 12 8,763,904 (GRCm39) missense probably damaging 0.98
R8166:Pum2 UTSW 12 8,771,739 (GRCm39) missense possibly damaging 0.71
R8316:Pum2 UTSW 12 8,763,456 (GRCm39) missense possibly damaging 0.89
R8345:Pum2 UTSW 12 8,759,454 (GRCm39) missense probably damaging 0.99
R8418:Pum2 UTSW 12 8,760,245 (GRCm39) missense possibly damaging 0.87
R8802:Pum2 UTSW 12 8,778,726 (GRCm39) nonsense probably null
R9039:Pum2 UTSW 12 8,794,430 (GRCm39) missense probably damaging 1.00
R9207:Pum2 UTSW 12 8,763,904 (GRCm39) missense probably damaging 0.98
R9366:Pum2 UTSW 12 8,783,344 (GRCm39) missense probably benign 0.02
R9700:Pum2 UTSW 12 8,779,044 (GRCm39) missense probably damaging 0.97
X0039:Pum2 UTSW 12 8,778,944 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TACTTAGTTCTTGGAAGCCTATAGC -3'
(R):5'- AGACTATTTGCAGTTCCTCCAGC -3'

Sequencing Primer
(F):5'- AAATACCTCAGATGTGGTTTTTCC -3'
(R):5'- AGTTCCTCCAGCTGCTGC -3'
Posted On 2014-09-17