Incidental Mutation 'R2060:Nin'
ID 228645
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Name ninein
Synonyms 3110068G20Rik
MMRRC Submission 040065-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2060 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 70058209-70160491 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 70089192 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 1408 (T1408S)
Ref Sequence ENSEMBL: ENSMUSP00000152350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]
AlphaFold Q61043
Predicted Effect probably benign
Transcript: ENSMUST00000021468
AA Change: T1408S

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: T1408S

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085314
AA Change: T1408S

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: T1408S

DomainStartEndE-ValueType
internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095666
AA Change: T1408S

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: T1408S

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169074
AA Change: T1408S

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: T1408S

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221486
Predicted Effect probably benign
Transcript: ENSMUST00000222237
AA Change: T1408S

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000222835
Predicted Effect possibly damaging
Transcript: ENSMUST00000223257
AA Change: T1408S

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223316
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 119,826,741 (GRCm39) W462* probably null Het
Aftph A T 11: 20,642,571 (GRCm39) Y821N probably damaging Het
Ahnak A T 19: 8,985,405 (GRCm39) M2230L probably benign Het
Arfgap1 T C 2: 180,614,575 (GRCm39) F144L probably benign Het
Arid4b C T 13: 14,370,037 (GRCm39) R1178C probably damaging Het
Asb8 A T 15: 98,039,254 (GRCm39) C49S possibly damaging Het
Baz1b A G 5: 135,233,968 (GRCm39) N165S probably damaging Het
Bod1l A T 5: 41,966,085 (GRCm39) I2660N possibly damaging Het
C2cd3 T C 7: 100,104,155 (GRCm39) I825T probably damaging Het
C4b A G 17: 34,955,075 (GRCm39) W804R probably damaging Het
Cadm3 A T 1: 173,171,969 (GRCm39) D201E probably damaging Het
Cdh17 T C 4: 11,803,982 (GRCm39) F552L probably benign Het
Cdh20 G C 1: 109,976,607 (GRCm39) A91P probably damaging Het
Cela1 A G 15: 100,573,203 (GRCm39) probably null Het
Clk3 T C 9: 57,658,400 (GRCm39) Y582C probably damaging Het
Cma1 C T 14: 56,181,155 (GRCm39) probably null Het
Ctcfl A G 2: 172,960,299 (GRCm39) S95P probably benign Het
Cylc1 C A X: 110,166,892 (GRCm39) T391K unknown Het
Cyp3a11 T A 5: 145,791,891 (GRCm39) I501L probably benign Het
Cyp3a59 T A 5: 146,041,524 (GRCm39) L356Q probably damaging Het
Dcdc2a A C 13: 25,291,693 (GRCm39) D226A possibly damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dlec1 A C 9: 118,941,154 (GRCm39) T235P probably damaging Het
Dnaaf1 G A 8: 120,317,341 (GRCm39) R290Q probably benign Het
Dnaaf5 C T 5: 139,163,758 (GRCm39) R377W probably damaging Het
Dpep1 T A 8: 123,927,130 (GRCm39) V293E probably damaging Het
Drosha T A 15: 12,924,245 (GRCm39) V1209E possibly damaging Het
Dync2h1 T G 9: 7,162,802 (GRCm39) I596L possibly damaging Het
Edem1 T A 6: 108,831,248 (GRCm39) Y570N probably damaging Het
Edrf1 G T 7: 133,258,858 (GRCm39) E9* probably null Het
Enpep T A 3: 129,074,172 (GRCm39) N792Y probably benign Het
Enpp2 A T 15: 54,739,110 (GRCm39) M391K probably damaging Het
Fanca A C 8: 124,001,220 (GRCm39) V1105G probably damaging Het
Fbxo22 T A 9: 55,125,667 (GRCm39) L74I probably damaging Het
Fchsd2 T A 7: 100,926,624 (GRCm39) F571L probably benign Het
Fhad1 T C 4: 141,626,560 (GRCm39) D1345G probably benign Het
G2e3 T C 12: 51,419,389 (GRCm39) F702L probably damaging Het
Glce A T 9: 61,968,228 (GRCm39) S308T possibly damaging Het
Glt1d1 A G 5: 127,734,183 (GRCm39) D119G probably benign Het
Gpr137c T C 14: 45,481,616 (GRCm39) I144T probably damaging Het
Gprin3 A G 6: 59,331,504 (GRCm39) C268R possibly damaging Het
Hadha G A 5: 30,333,834 (GRCm39) T395M probably benign Het
Hdhd2 T G 18: 77,052,738 (GRCm39) probably null Het
Homer2 C T 7: 81,268,451 (GRCm39) E70K probably benign Het
Hp1bp3 T A 4: 137,967,983 (GRCm39) D397E probably damaging Het
Hrh3 T C 2: 179,743,043 (GRCm39) N195S possibly damaging Het
Hyou1 T C 9: 44,292,849 (GRCm39) V153A probably benign Het
Igf2r A T 17: 12,920,206 (GRCm39) S1378T possibly damaging Het
Ints4 G A 7: 97,150,970 (GRCm39) R279H possibly damaging Het
Itga10 A T 3: 96,562,314 (GRCm39) R699* probably null Het
Itpkb A G 1: 180,249,423 (GRCm39) T933A probably benign Het
Itsn2 T G 12: 4,677,879 (GRCm39) F79V probably damaging Het
Jak3 C A 8: 72,133,358 (GRCm39) C350* probably null Het
Jak3 A T 8: 72,136,059 (GRCm39) K620* probably null Het
Kcnq5 T C 1: 21,531,821 (GRCm39) S421G probably benign Het
Kdm2b A T 5: 123,021,428 (GRCm39) M50K probably damaging Het
Klk1b1 A G 7: 43,620,047 (GRCm39) D170G possibly damaging Het
Lama3 A T 18: 12,661,783 (GRCm39) T2160S probably benign Het
Lman1 A T 18: 66,131,423 (GRCm39) probably benign Het
Lmtk3 G A 7: 45,450,335 (GRCm39) probably null Het
Ltb A G 17: 35,414,739 (GRCm39) R180G probably damaging Het
Ltbp4 C T 7: 27,008,378 (GRCm39) R1310Q probably damaging Het
Macf1 T A 4: 123,393,712 (GRCm39) probably null Het
Mast4 G T 13: 102,875,354 (GRCm39) P1146Q probably damaging Het
Micall2 C T 5: 139,697,317 (GRCm39) S678N probably damaging Het
Mon2 A T 10: 122,831,681 (GRCm39) I1675N probably damaging Het
Mug2 A G 6: 122,056,571 (GRCm39) N1172S probably benign Het
Naa30 C G 14: 49,410,556 (GRCm39) S161R possibly damaging Het
Ncaph T C 2: 126,966,795 (GRCm39) N220D probably damaging Het
Nell1 T C 7: 50,210,578 (GRCm39) V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 (GRCm38) N142S possibly damaging Het
Nlrp4g T A 9: 124,349,693 (GRCm38) noncoding transcript Het
Nrg1 T G 8: 32,408,043 (GRCm39) E63D probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or14j7 A G 17: 38,234,771 (GRCm39) T105A probably benign Het
Or5d39 T C 2: 87,979,487 (GRCm39) Y292C probably damaging Het
Or5g29 G A 2: 85,421,627 (GRCm39) V248I possibly damaging Het
Or5p53 C T 7: 107,532,868 (GRCm39) T47M probably benign Het
Or6ae1 T A 7: 139,742,737 (GRCm39) E42V probably damaging Het
Or7d11 A T 9: 19,965,892 (GRCm39) I289N probably damaging Het
Or7g27 A G 9: 19,250,352 (GRCm39) I199V probably benign Het
Or7g32 T A 9: 19,408,533 (GRCm39) V163E possibly damaging Het
Orc5 C T 5: 22,721,701 (GRCm39) probably null Het
Pard3 G A 8: 128,125,085 (GRCm39) R691Q probably benign Het
Pofut1 T A 2: 153,085,580 (GRCm39) D54E probably benign Het
Prl2c5 T A 13: 13,365,238 (GRCm39) V128E probably damaging Het
Ptk7 T C 17: 46,877,164 (GRCm39) M965V possibly damaging Het
Pum2 C T 12: 8,778,726 (GRCm39) R459* probably null Het
Pzp A T 6: 128,460,673 (GRCm39) N1494K probably benign Het
Rad21l A G 2: 151,487,349 (GRCm39) V545A probably benign Het
Rps6kc1 A T 1: 190,542,305 (GRCm39) M352K possibly damaging Het
Rpusd2 G A 2: 118,867,696 (GRCm39) probably null Het
Rsph14 A T 10: 74,865,603 (GRCm39) D78E probably damaging Het
Rtl9 A T X: 141,885,026 (GRCm39) M813L possibly damaging Het
Rtp4 A T 16: 23,431,690 (GRCm39) H74L probably damaging Het
Rusc1 G A 3: 88,995,155 (GRCm39) T725I possibly damaging Het
Rusf1 A G 7: 127,887,503 (GRCm39) L176P probably damaging Het
Ryr2 C T 13: 11,610,622 (GRCm39) C4068Y probably damaging Het
Ryr3 A G 2: 112,784,709 (GRCm39) V224A possibly damaging Het
Shprh A T 10: 11,027,864 (GRCm39) N157I probably benign Het
Siglece A G 7: 43,307,210 (GRCm39) I67T probably benign Het
Slc9b2 A T 3: 135,032,027 (GRCm39) T296S probably damaging Het
Sorbs2 A G 8: 46,228,666 (GRCm39) K276E probably damaging Het
Synj2 A G 17: 6,087,755 (GRCm39) T1269A probably benign Het
Taar7b T C 10: 23,876,573 (GRCm39) I246T possibly damaging Het
Taldo1 A G 7: 140,976,067 (GRCm39) Y113C probably damaging Het
Tarbp1 A T 8: 127,174,333 (GRCm39) probably null Het
Tars1 C T 15: 11,394,459 (GRCm39) M59I probably benign Het
Tas2r130 G A 6: 131,607,780 (GRCm39) T5I probably benign Het
Tex48 T C 4: 63,525,652 (GRCm39) E77G probably damaging Het
Tmco5 A G 2: 116,722,736 (GRCm39) R286G probably damaging Het
Trdmt1 A T 2: 13,524,725 (GRCm39) H243Q probably benign Het
Ttn T A 2: 76,564,638 (GRCm39) R26754* probably null Het
Ttn G A 2: 76,727,924 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,791,358 (GRCm39) L244R probably damaging Het
Ubxn1 C T 19: 8,850,930 (GRCm39) R115* probably null Het
Umod T G 7: 119,075,938 (GRCm39) N276T probably damaging Het
Unc13c A T 9: 73,572,938 (GRCm39) L1528Q probably damaging Het
Unc80 T A 1: 66,679,754 (GRCm39) H2108Q possibly damaging Het
Utp20 A C 10: 88,610,657 (GRCm39) D1442E probably damaging Het
Utp4 A G 8: 107,625,153 (GRCm39) Q144R probably benign Het
Vmn2r17 T A 5: 109,575,075 (GRCm39) N127K probably benign Het
Vmn2r75 T A 7: 85,814,372 (GRCm39) T374S probably benign Het
Washc5 A G 15: 59,222,257 (GRCm39) F523L probably damaging Het
Wdr3 A T 3: 100,067,213 (GRCm39) probably null Het
Wdr89 T C 12: 75,679,762 (GRCm39) Y164C probably damaging Het
Xpo5 T C 17: 46,536,017 (GRCm39) S550P probably damaging Het
Zfp69 T C 4: 120,788,029 (GRCm39) T429A probably damaging Het
Zfpm1 G T 8: 123,063,331 (GRCm39) G797C probably benign Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70,076,862 (GRCm39) missense probably damaging 0.98
IGL00677:Nin APN 12 70,073,634 (GRCm39) missense probably damaging 1.00
IGL00823:Nin APN 12 70,061,567 (GRCm39) missense probably benign 0.01
IGL01103:Nin APN 12 70,103,532 (GRCm39) missense probably damaging 0.99
IGL01113:Nin APN 12 70,078,553 (GRCm39) missense probably damaging 1.00
IGL01420:Nin APN 12 70,092,188 (GRCm39) missense probably benign 0.08
IGL01556:Nin APN 12 70,089,962 (GRCm39) missense probably benign 0.01
IGL01663:Nin APN 12 70,090,439 (GRCm39) missense possibly damaging 0.72
IGL02002:Nin APN 12 70,109,473 (GRCm39) nonsense probably null
IGL02030:Nin APN 12 70,092,042 (GRCm39) missense probably damaging 1.00
IGL02202:Nin APN 12 70,102,210 (GRCm39) missense probably damaging 1.00
IGL02207:Nin APN 12 70,103,431 (GRCm39) missense probably damaging 0.99
IGL02257:Nin APN 12 70,149,465 (GRCm39) missense possibly damaging 0.71
IGL02394:Nin APN 12 70,090,805 (GRCm39) missense probably damaging 1.00
IGL02531:Nin APN 12 70,067,706 (GRCm39) missense probably benign 0.02
IGL03028:Nin APN 12 70,082,044 (GRCm39) missense probably benign 0.13
IGL03155:Nin APN 12 70,078,544 (GRCm39) missense probably damaging 1.00
IGL03197:Nin APN 12 70,073,584 (GRCm39) missense probably benign 0.03
IGL02835:Nin UTSW 12 70,103,512 (GRCm39) missense probably damaging 1.00
R0131:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0131:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0132:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0211:Nin UTSW 12 70,061,649 (GRCm39) missense probably damaging 1.00
R0211:Nin UTSW 12 70,061,649 (GRCm39) missense probably damaging 1.00
R0734:Nin UTSW 12 70,076,887 (GRCm39) missense probably benign 0.01
R0947:Nin UTSW 12 70,107,960 (GRCm39) missense probably damaging 1.00
R1085:Nin UTSW 12 70,067,736 (GRCm39) missense possibly damaging 0.91
R1367:Nin UTSW 12 70,090,703 (GRCm39) missense probably damaging 0.99
R1452:Nin UTSW 12 70,064,424 (GRCm39) nonsense probably null
R1477:Nin UTSW 12 70,090,958 (GRCm39) missense possibly damaging 0.87
R1518:Nin UTSW 12 70,061,547 (GRCm39) missense probably benign 0.27
R1566:Nin UTSW 12 70,101,253 (GRCm39) missense probably damaging 0.99
R1572:Nin UTSW 12 70,085,524 (GRCm39) missense probably damaging 1.00
R1583:Nin UTSW 12 70,078,512 (GRCm39) missense probably benign
R1584:Nin UTSW 12 70,089,443 (GRCm39) missense probably benign 0.03
R1699:Nin UTSW 12 70,092,337 (GRCm39) missense possibly damaging 0.87
R1699:Nin UTSW 12 70,077,712 (GRCm39) missense probably benign 0.40
R1765:Nin UTSW 12 70,089,665 (GRCm39) missense probably damaging 1.00
R1794:Nin UTSW 12 70,090,569 (GRCm39) nonsense probably null
R1952:Nin UTSW 12 70,077,700 (GRCm39) missense probably damaging 1.00
R2004:Nin UTSW 12 70,072,251 (GRCm39) missense probably benign 0.01
R2025:Nin UTSW 12 70,076,782 (GRCm39) missense probably damaging 1.00
R2213:Nin UTSW 12 70,092,128 (GRCm39) missense probably damaging 1.00
R2224:Nin UTSW 12 70,108,004 (GRCm39) missense probably damaging 1.00
R2247:Nin UTSW 12 70,101,319 (GRCm39) missense probably damaging 1.00
R2972:Nin UTSW 12 70,109,487 (GRCm39) missense probably damaging 1.00
R3776:Nin UTSW 12 70,085,456 (GRCm39) missense possibly damaging 0.71
R3881:Nin UTSW 12 70,089,315 (GRCm39) missense probably benign 0.00
R3930:Nin UTSW 12 70,125,016 (GRCm39) missense probably damaging 1.00
R3959:Nin UTSW 12 70,097,526 (GRCm39) missense probably damaging 1.00
R4229:Nin UTSW 12 70,097,984 (GRCm39) missense probably damaging 0.99
R4359:Nin UTSW 12 70,061,712 (GRCm39) missense probably benign 0.00
R4423:Nin UTSW 12 70,089,752 (GRCm39) missense probably damaging 1.00
R4461:Nin UTSW 12 70,089,359 (GRCm39) missense probably benign 0.37
R4639:Nin UTSW 12 70,085,375 (GRCm39) missense probably damaging 0.97
R4791:Nin UTSW 12 70,090,581 (GRCm39) missense possibly damaging 0.94
R4839:Nin UTSW 12 70,137,325 (GRCm39) missense possibly damaging 0.46
R4912:Nin UTSW 12 70,090,837 (GRCm39) missense probably damaging 1.00
R5712:Nin UTSW 12 70,089,543 (GRCm39) missense probably damaging 1.00
R5726:Nin UTSW 12 70,124,953 (GRCm39) missense probably damaging 1.00
R5804:Nin UTSW 12 70,092,375 (GRCm39) missense possibly damaging 0.58
R5874:Nin UTSW 12 70,077,692 (GRCm39) missense possibly damaging 0.94
R5992:Nin UTSW 12 70,092,298 (GRCm39) missense possibly damaging 0.83
R6077:Nin UTSW 12 70,066,006 (GRCm39) missense probably damaging 1.00
R6184:Nin UTSW 12 70,090,511 (GRCm39) missense probably damaging 1.00
R6307:Nin UTSW 12 70,061,631 (GRCm39) missense possibly damaging 0.91
R6315:Nin UTSW 12 70,092,389 (GRCm39) missense probably damaging 1.00
R6326:Nin UTSW 12 70,091,955 (GRCm39) missense possibly damaging 0.95
R6492:Nin UTSW 12 70,101,308 (GRCm39) missense probably benign 0.22
R6562:Nin UTSW 12 70,102,728 (GRCm39) missense probably damaging 1.00
R6578:Nin UTSW 12 70,107,968 (GRCm39) missense probably damaging 0.99
R6613:Nin UTSW 12 70,077,728 (GRCm39) missense probably damaging 1.00
R7112:Nin UTSW 12 70,149,573 (GRCm39) missense
R7170:Nin UTSW 12 70,091,013 (GRCm39) missense
R7324:Nin UTSW 12 70,090,508 (GRCm39) missense
R7338:Nin UTSW 12 70,090,838 (GRCm39) missense
R7372:Nin UTSW 12 70,102,803 (GRCm39) missense
R7431:Nin UTSW 12 70,124,997 (GRCm39) missense
R7577:Nin UTSW 12 70,109,480 (GRCm39) missense
R7655:Nin UTSW 12 70,089,542 (GRCm39) missense
R7656:Nin UTSW 12 70,089,542 (GRCm39) missense
R7683:Nin UTSW 12 70,124,956 (GRCm39) missense
R7769:Nin UTSW 12 70,090,004 (GRCm39) missense
R7981:Nin UTSW 12 70,089,591 (GRCm39) missense
R8138:Nin UTSW 12 70,089,672 (GRCm39) missense
R8141:Nin UTSW 12 70,076,795 (GRCm39) missense
R8754:Nin UTSW 12 70,077,787 (GRCm39) intron probably benign
R8790:Nin UTSW 12 70,067,793 (GRCm39) missense
R8899:Nin UTSW 12 70,077,710 (GRCm39) missense probably damaging 1.00
R8974:Nin UTSW 12 70,124,932 (GRCm39) missense
R9085:Nin UTSW 12 70,076,786 (GRCm39) nonsense probably null
R9143:Nin UTSW 12 70,137,349 (GRCm39) missense
R9380:Nin UTSW 12 70,074,805 (GRCm39) missense
R9496:Nin UTSW 12 70,102,762 (GRCm39) missense
R9638:Nin UTSW 12 70,067,618 (GRCm39) missense
R9709:Nin UTSW 12 70,149,468 (GRCm39) missense
R9745:Nin UTSW 12 70,089,899 (GRCm39) missense
R9792:Nin UTSW 12 70,094,009 (GRCm39) missense
Z1176:Nin UTSW 12 70,095,938 (GRCm39) critical splice acceptor site probably null
Z1177:Nin UTSW 12 70,101,200 (GRCm39) missense
Z1177:Nin UTSW 12 70,090,869 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GGAGTTCAACCTTCCTCTGC -3'
(R):5'- TGCTTGAACTCCGTCAGACTC -3'

Sequencing Primer
(F):5'- TGCCTAACTAGTGCAGTGAC -3'
(R):5'- TCCGAAAGAGTGTACGCCC -3'
Posted On 2014-09-17