Incidental Mutation 'R2060:Mast4'
ID 228651
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Name microtubule associated serine/threonine kinase family member 4
Synonyms 4930420O11Rik
MMRRC Submission 040065-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.226) question?
Stock # R2060 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 102868994-103471005 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 102875354 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 1146 (P1146Q)
Ref Sequence ENSEMBL: ENSMUSP00000131651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000170878] [ENSMUST00000171791] [ENSMUST00000172138]
AlphaFold Q811L6
Predicted Effect probably damaging
Transcript: ENSMUST00000099202
AA Change: P1161Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: P1161Q

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166726
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167058
AA Change: P1338Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: P1338Q

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167462
SMART Domains Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 3e-145 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 843 878 N/A INTRINSIC
PDZ 888 968 2.34e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170878
SMART Domains Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 3e-38 PDB
SCOP:d1m0za_ 35 84 4e-4 SMART
Blast:LRR 51 75 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000171791
AA Change: P1146Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: P1146Q

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 1.2e-144 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 825 842 N/A INTRINSIC
low complexity region 910 945 N/A INTRINSIC
PDZ 955 1035 2.34e-15 SMART
low complexity region 1055 1072 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1127 1149 N/A INTRINSIC
low complexity region 1187 1204 N/A INTRINSIC
low complexity region 1275 1291 N/A INTRINSIC
low complexity region 1330 1346 N/A INTRINSIC
low complexity region 1922 1938 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2135 2146 N/A INTRINSIC
low complexity region 2281 2292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172138
Predicted Effect unknown
Transcript: ENSMUST00000194446
AA Change: P1170Q
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 119,826,741 (GRCm39) W462* probably null Het
Aftph A T 11: 20,642,571 (GRCm39) Y821N probably damaging Het
Ahnak A T 19: 8,985,405 (GRCm39) M2230L probably benign Het
Arfgap1 T C 2: 180,614,575 (GRCm39) F144L probably benign Het
Arid4b C T 13: 14,370,037 (GRCm39) R1178C probably damaging Het
Asb8 A T 15: 98,039,254 (GRCm39) C49S possibly damaging Het
Baz1b A G 5: 135,233,968 (GRCm39) N165S probably damaging Het
Bod1l A T 5: 41,966,085 (GRCm39) I2660N possibly damaging Het
C2cd3 T C 7: 100,104,155 (GRCm39) I825T probably damaging Het
C4b A G 17: 34,955,075 (GRCm39) W804R probably damaging Het
Cadm3 A T 1: 173,171,969 (GRCm39) D201E probably damaging Het
Cdh17 T C 4: 11,803,982 (GRCm39) F552L probably benign Het
Cdh20 G C 1: 109,976,607 (GRCm39) A91P probably damaging Het
Cela1 A G 15: 100,573,203 (GRCm39) probably null Het
Clk3 T C 9: 57,658,400 (GRCm39) Y582C probably damaging Het
Cma1 C T 14: 56,181,155 (GRCm39) probably null Het
Ctcfl A G 2: 172,960,299 (GRCm39) S95P probably benign Het
Cylc1 C A X: 110,166,892 (GRCm39) T391K unknown Het
Cyp3a11 T A 5: 145,791,891 (GRCm39) I501L probably benign Het
Cyp3a59 T A 5: 146,041,524 (GRCm39) L356Q probably damaging Het
Dcdc2a A C 13: 25,291,693 (GRCm39) D226A possibly damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dlec1 A C 9: 118,941,154 (GRCm39) T235P probably damaging Het
Dnaaf1 G A 8: 120,317,341 (GRCm39) R290Q probably benign Het
Dnaaf5 C T 5: 139,163,758 (GRCm39) R377W probably damaging Het
Dpep1 T A 8: 123,927,130 (GRCm39) V293E probably damaging Het
Drosha T A 15: 12,924,245 (GRCm39) V1209E possibly damaging Het
Dync2h1 T G 9: 7,162,802 (GRCm39) I596L possibly damaging Het
Edem1 T A 6: 108,831,248 (GRCm39) Y570N probably damaging Het
Edrf1 G T 7: 133,258,858 (GRCm39) E9* probably null Het
Enpep T A 3: 129,074,172 (GRCm39) N792Y probably benign Het
Enpp2 A T 15: 54,739,110 (GRCm39) M391K probably damaging Het
Fanca A C 8: 124,001,220 (GRCm39) V1105G probably damaging Het
Fbxo22 T A 9: 55,125,667 (GRCm39) L74I probably damaging Het
Fchsd2 T A 7: 100,926,624 (GRCm39) F571L probably benign Het
Fhad1 T C 4: 141,626,560 (GRCm39) D1345G probably benign Het
G2e3 T C 12: 51,419,389 (GRCm39) F702L probably damaging Het
Glce A T 9: 61,968,228 (GRCm39) S308T possibly damaging Het
Glt1d1 A G 5: 127,734,183 (GRCm39) D119G probably benign Het
Gpr137c T C 14: 45,481,616 (GRCm39) I144T probably damaging Het
Gprin3 A G 6: 59,331,504 (GRCm39) C268R possibly damaging Het
Hadha G A 5: 30,333,834 (GRCm39) T395M probably benign Het
Hdhd2 T G 18: 77,052,738 (GRCm39) probably null Het
Homer2 C T 7: 81,268,451 (GRCm39) E70K probably benign Het
Hp1bp3 T A 4: 137,967,983 (GRCm39) D397E probably damaging Het
Hrh3 T C 2: 179,743,043 (GRCm39) N195S possibly damaging Het
Hyou1 T C 9: 44,292,849 (GRCm39) V153A probably benign Het
Igf2r A T 17: 12,920,206 (GRCm39) S1378T possibly damaging Het
Ints4 G A 7: 97,150,970 (GRCm39) R279H possibly damaging Het
Itga10 A T 3: 96,562,314 (GRCm39) R699* probably null Het
Itpkb A G 1: 180,249,423 (GRCm39) T933A probably benign Het
Itsn2 T G 12: 4,677,879 (GRCm39) F79V probably damaging Het
Jak3 C A 8: 72,133,358 (GRCm39) C350* probably null Het
Jak3 A T 8: 72,136,059 (GRCm39) K620* probably null Het
Kcnq5 T C 1: 21,531,821 (GRCm39) S421G probably benign Het
Kdm2b A T 5: 123,021,428 (GRCm39) M50K probably damaging Het
Klk1b1 A G 7: 43,620,047 (GRCm39) D170G possibly damaging Het
Lama3 A T 18: 12,661,783 (GRCm39) T2160S probably benign Het
Lman1 A T 18: 66,131,423 (GRCm39) probably benign Het
Lmtk3 G A 7: 45,450,335 (GRCm39) probably null Het
Ltb A G 17: 35,414,739 (GRCm39) R180G probably damaging Het
Ltbp4 C T 7: 27,008,378 (GRCm39) R1310Q probably damaging Het
Macf1 T A 4: 123,393,712 (GRCm39) probably null Het
Micall2 C T 5: 139,697,317 (GRCm39) S678N probably damaging Het
Mon2 A T 10: 122,831,681 (GRCm39) I1675N probably damaging Het
Mug2 A G 6: 122,056,571 (GRCm39) N1172S probably benign Het
Naa30 C G 14: 49,410,556 (GRCm39) S161R possibly damaging Het
Ncaph T C 2: 126,966,795 (GRCm39) N220D probably damaging Het
Nell1 T C 7: 50,210,578 (GRCm39) V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 (GRCm38) N142S possibly damaging Het
Nin T A 12: 70,089,192 (GRCm39) T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 (GRCm38) noncoding transcript Het
Nrg1 T G 8: 32,408,043 (GRCm39) E63D probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or14j7 A G 17: 38,234,771 (GRCm39) T105A probably benign Het
Or5d39 T C 2: 87,979,487 (GRCm39) Y292C probably damaging Het
Or5g29 G A 2: 85,421,627 (GRCm39) V248I possibly damaging Het
Or5p53 C T 7: 107,532,868 (GRCm39) T47M probably benign Het
Or6ae1 T A 7: 139,742,737 (GRCm39) E42V probably damaging Het
Or7d11 A T 9: 19,965,892 (GRCm39) I289N probably damaging Het
Or7g27 A G 9: 19,250,352 (GRCm39) I199V probably benign Het
Or7g32 T A 9: 19,408,533 (GRCm39) V163E possibly damaging Het
Orc5 C T 5: 22,721,701 (GRCm39) probably null Het
Pard3 G A 8: 128,125,085 (GRCm39) R691Q probably benign Het
Pofut1 T A 2: 153,085,580 (GRCm39) D54E probably benign Het
Prl2c5 T A 13: 13,365,238 (GRCm39) V128E probably damaging Het
Ptk7 T C 17: 46,877,164 (GRCm39) M965V possibly damaging Het
Pum2 C T 12: 8,778,726 (GRCm39) R459* probably null Het
Pzp A T 6: 128,460,673 (GRCm39) N1494K probably benign Het
Rad21l A G 2: 151,487,349 (GRCm39) V545A probably benign Het
Rps6kc1 A T 1: 190,542,305 (GRCm39) M352K possibly damaging Het
Rpusd2 G A 2: 118,867,696 (GRCm39) probably null Het
Rsph14 A T 10: 74,865,603 (GRCm39) D78E probably damaging Het
Rtl9 A T X: 141,885,026 (GRCm39) M813L possibly damaging Het
Rtp4 A T 16: 23,431,690 (GRCm39) H74L probably damaging Het
Rusc1 G A 3: 88,995,155 (GRCm39) T725I possibly damaging Het
Rusf1 A G 7: 127,887,503 (GRCm39) L176P probably damaging Het
Ryr2 C T 13: 11,610,622 (GRCm39) C4068Y probably damaging Het
Ryr3 A G 2: 112,784,709 (GRCm39) V224A possibly damaging Het
Shprh A T 10: 11,027,864 (GRCm39) N157I probably benign Het
Siglece A G 7: 43,307,210 (GRCm39) I67T probably benign Het
Slc9b2 A T 3: 135,032,027 (GRCm39) T296S probably damaging Het
Sorbs2 A G 8: 46,228,666 (GRCm39) K276E probably damaging Het
Synj2 A G 17: 6,087,755 (GRCm39) T1269A probably benign Het
Taar7b T C 10: 23,876,573 (GRCm39) I246T possibly damaging Het
Taldo1 A G 7: 140,976,067 (GRCm39) Y113C probably damaging Het
Tarbp1 A T 8: 127,174,333 (GRCm39) probably null Het
Tars1 C T 15: 11,394,459 (GRCm39) M59I probably benign Het
Tas2r130 G A 6: 131,607,780 (GRCm39) T5I probably benign Het
Tex48 T C 4: 63,525,652 (GRCm39) E77G probably damaging Het
Tmco5 A G 2: 116,722,736 (GRCm39) R286G probably damaging Het
Trdmt1 A T 2: 13,524,725 (GRCm39) H243Q probably benign Het
Ttn T A 2: 76,564,638 (GRCm39) R26754* probably null Het
Ttn G A 2: 76,727,924 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,791,358 (GRCm39) L244R probably damaging Het
Ubxn1 C T 19: 8,850,930 (GRCm39) R115* probably null Het
Umod T G 7: 119,075,938 (GRCm39) N276T probably damaging Het
Unc13c A T 9: 73,572,938 (GRCm39) L1528Q probably damaging Het
Unc80 T A 1: 66,679,754 (GRCm39) H2108Q possibly damaging Het
Utp20 A C 10: 88,610,657 (GRCm39) D1442E probably damaging Het
Utp4 A G 8: 107,625,153 (GRCm39) Q144R probably benign Het
Vmn2r17 T A 5: 109,575,075 (GRCm39) N127K probably benign Het
Vmn2r75 T A 7: 85,814,372 (GRCm39) T374S probably benign Het
Washc5 A G 15: 59,222,257 (GRCm39) F523L probably damaging Het
Wdr3 A T 3: 100,067,213 (GRCm39) probably null Het
Wdr89 T C 12: 75,679,762 (GRCm39) Y164C probably damaging Het
Xpo5 T C 17: 46,536,017 (GRCm39) S550P probably damaging Het
Zfp69 T C 4: 120,788,029 (GRCm39) T429A probably damaging Het
Zfpm1 G T 8: 123,063,331 (GRCm39) G797C probably benign Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102,907,275 (GRCm39) nonsense probably null
IGL00933:Mast4 APN 13 102,871,874 (GRCm39) missense probably damaging 0.97
IGL01113:Mast4 APN 13 102,910,744 (GRCm39) missense probably damaging 1.00
IGL01461:Mast4 APN 13 102,890,576 (GRCm39) missense probably damaging 1.00
IGL01569:Mast4 APN 13 102,897,523 (GRCm39) missense probably damaging 1.00
IGL01697:Mast4 APN 13 102,904,401 (GRCm39) missense probably damaging 1.00
IGL01725:Mast4 APN 13 102,887,020 (GRCm39) critical splice donor site probably null
IGL01734:Mast4 APN 13 102,874,123 (GRCm39) missense probably damaging 0.98
IGL01738:Mast4 APN 13 102,873,749 (GRCm39) missense probably damaging 1.00
IGL01739:Mast4 APN 13 102,910,781 (GRCm39) missense probably damaging 1.00
IGL02299:Mast4 APN 13 102,874,482 (GRCm39) missense probably benign 0.44
IGL02479:Mast4 APN 13 102,878,545 (GRCm39) missense probably damaging 1.00
IGL02485:Mast4 APN 13 102,872,004 (GRCm39) missense probably benign 0.02
IGL02528:Mast4 APN 13 102,990,331 (GRCm39) makesense probably null
IGL02850:Mast4 APN 13 102,890,740 (GRCm39) missense probably damaging 1.00
IGL02900:Mast4 APN 13 102,872,184 (GRCm39) missense probably benign
IGL03064:Mast4 APN 13 102,897,472 (GRCm39) nonsense probably null
IGL03124:Mast4 APN 13 102,874,753 (GRCm39) missense probably damaging 1.00
IGL03146:Mast4 APN 13 102,874,163 (GRCm39) missense probably benign 0.00
IGL03221:Mast4 APN 13 102,890,764 (GRCm39) missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102,887,905 (GRCm39) missense probably damaging 1.00
IGL03406:Mast4 APN 13 102,873,615 (GRCm39) missense possibly damaging 0.46
buck UTSW 13 102,897,801 (GRCm39) critical splice donor site probably null
doe UTSW 13 103,042,185 (GRCm39) missense possibly damaging 0.85
skinnybones UTSW 13 102,941,149 (GRCm39) critical splice donor site probably null
BB010:Mast4 UTSW 13 102,909,071 (GRCm39) missense probably damaging 0.99
BB020:Mast4 UTSW 13 102,909,071 (GRCm39) missense probably damaging 0.99
FR4304:Mast4 UTSW 13 102,871,370 (GRCm39) utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102,872,825 (GRCm39) small insertion probably benign
FR4340:Mast4 UTSW 13 102,871,365 (GRCm39) frame shift probably null
FR4548:Mast4 UTSW 13 102,872,826 (GRCm39) small insertion probably benign
FR4976:Mast4 UTSW 13 102,875,755 (GRCm39) frame shift probably null
FR4976:Mast4 UTSW 13 102,872,820 (GRCm39) small insertion probably benign
NA:Mast4 UTSW 13 102,878,565 (GRCm39) missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102,941,226 (GRCm39) missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102,941,226 (GRCm39) missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102,941,226 (GRCm39) missense probably damaging 1.00
R0009:Mast4 UTSW 13 102,878,566 (GRCm39) missense probably damaging 1.00
R0063:Mast4 UTSW 13 103,470,723 (GRCm39) start gained probably benign
R0242:Mast4 UTSW 13 102,990,350 (GRCm39) missense probably damaging 1.00
R0310:Mast4 UTSW 13 102,890,669 (GRCm39) missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102,871,781 (GRCm39) missense probably damaging 1.00
R0454:Mast4 UTSW 13 102,888,068 (GRCm39) missense probably damaging 1.00
R0646:Mast4 UTSW 13 102,895,252 (GRCm39) splice site probably benign
R0744:Mast4 UTSW 13 102,873,895 (GRCm39) missense probably damaging 0.98
R0883:Mast4 UTSW 13 102,990,408 (GRCm39) missense probably damaging 1.00
R0905:Mast4 UTSW 13 102,907,292 (GRCm39) missense probably damaging 0.99
R1023:Mast4 UTSW 13 102,872,004 (GRCm39) missense probably benign 0.02
R1281:Mast4 UTSW 13 102,887,086 (GRCm39) missense probably damaging 1.00
R1376:Mast4 UTSW 13 102,872,916 (GRCm39) missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102,872,916 (GRCm39) missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102,909,027 (GRCm39) missense probably damaging 1.00
R1572:Mast4 UTSW 13 102,873,431 (GRCm39) missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102,875,771 (GRCm39) missense probably damaging 1.00
R1865:Mast4 UTSW 13 102,930,625 (GRCm39) missense probably damaging 1.00
R2050:Mast4 UTSW 13 102,887,917 (GRCm39) missense probably damaging 1.00
R2062:Mast4 UTSW 13 102,895,601 (GRCm39) missense probably benign 0.18
R2106:Mast4 UTSW 13 102,887,054 (GRCm39) missense probably damaging 1.00
R2118:Mast4 UTSW 13 102,890,713 (GRCm39) missense probably damaging 1.00
R2143:Mast4 UTSW 13 102,871,983 (GRCm39) missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102,872,259 (GRCm39) missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102,934,715 (GRCm39) splice site probably benign
R2370:Mast4 UTSW 13 102,910,695 (GRCm39) missense probably damaging 1.00
R2504:Mast4 UTSW 13 102,875,147 (GRCm39) missense probably damaging 0.96
R2509:Mast4 UTSW 13 102,990,350 (GRCm39) missense probably damaging 1.00
R2842:Mast4 UTSW 13 102,872,939 (GRCm39) missense probably benign 0.01
R3087:Mast4 UTSW 13 102,990,434 (GRCm39) splice site probably benign
R3434:Mast4 UTSW 13 102,923,887 (GRCm39) missense probably damaging 1.00
R3435:Mast4 UTSW 13 102,923,887 (GRCm39) missense probably damaging 1.00
R3763:Mast4 UTSW 13 102,923,927 (GRCm39) missense probably damaging 1.00
R3826:Mast4 UTSW 13 102,875,319 (GRCm39) missense probably damaging 1.00
R3829:Mast4 UTSW 13 102,875,319 (GRCm39) missense probably damaging 1.00
R3830:Mast4 UTSW 13 102,875,319 (GRCm39) missense probably damaging 1.00
R3913:Mast4 UTSW 13 102,895,177 (GRCm39) missense probably damaging 1.00
R3914:Mast4 UTSW 13 102,875,829 (GRCm39) nonsense probably null
R4021:Mast4 UTSW 13 102,875,829 (GRCm39) nonsense probably null
R4022:Mast4 UTSW 13 102,990,377 (GRCm39) missense probably damaging 1.00
R4022:Mast4 UTSW 13 102,875,829 (GRCm39) nonsense probably null
R4210:Mast4 UTSW 13 102,875,713 (GRCm39) missense probably damaging 1.00
R4342:Mast4 UTSW 13 102,910,756 (GRCm39) missense probably damaging 1.00
R4580:Mast4 UTSW 13 102,873,766 (GRCm39) nonsense probably null
R4627:Mast4 UTSW 13 103,470,529 (GRCm39) missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103,470,627 (GRCm39) missense probably benign 0.01
R4732:Mast4 UTSW 13 102,909,080 (GRCm39) missense probably damaging 0.99
R4733:Mast4 UTSW 13 102,909,080 (GRCm39) missense probably damaging 0.99
R4833:Mast4 UTSW 13 102,910,692 (GRCm39) critical splice donor site probably null
R4995:Mast4 UTSW 13 103,042,262 (GRCm39) intron probably benign
R5059:Mast4 UTSW 13 102,887,071 (GRCm39) missense probably damaging 1.00
R5073:Mast4 UTSW 13 102,875,391 (GRCm39) nonsense probably null
R5101:Mast4 UTSW 13 102,872,864 (GRCm39) missense probably benign 0.01
R5526:Mast4 UTSW 13 102,890,723 (GRCm39) missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102,873,987 (GRCm39) missense probably damaging 1.00
R5673:Mast4 UTSW 13 102,930,580 (GRCm39) missense probably damaging 1.00
R5694:Mast4 UTSW 13 102,910,701 (GRCm39) nonsense probably null
R5906:Mast4 UTSW 13 102,872,252 (GRCm39) missense probably benign 0.31
R5908:Mast4 UTSW 13 102,874,764 (GRCm39) missense probably damaging 1.00
R5947:Mast4 UTSW 13 102,872,148 (GRCm39) missense probably benign
R5987:Mast4 UTSW 13 102,895,242 (GRCm39) missense probably damaging 1.00
R6143:Mast4 UTSW 13 102,990,391 (GRCm39) missense probably damaging 1.00
R6154:Mast4 UTSW 13 102,923,929 (GRCm39) missense probably damaging 1.00
R6169:Mast4 UTSW 13 102,923,929 (GRCm39) missense probably damaging 1.00
R6239:Mast4 UTSW 13 102,872,717 (GRCm39) missense probably benign 0.01
R6327:Mast4 UTSW 13 102,897,890 (GRCm39) missense probably damaging 1.00
R6356:Mast4 UTSW 13 102,872,493 (GRCm39) missense possibly damaging 0.80
R6432:Mast4 UTSW 13 103,042,185 (GRCm39) missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102,897,801 (GRCm39) critical splice donor site probably null
R6667:Mast4 UTSW 13 102,874,004 (GRCm39) missense probably damaging 1.00
R6941:Mast4 UTSW 13 102,941,222 (GRCm39) missense probably damaging 1.00
R6968:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6968:Mast4 UTSW 13 102,934,586 (GRCm39) missense probably damaging 1.00
R6970:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6980:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6991:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6992:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R6993:Mast4 UTSW 13 102,872,482 (GRCm39) missense probably benign 0.28
R6993:Mast4 UTSW 13 102,941,155 (GRCm39) missense probably damaging 1.00
R7083:Mast4 UTSW 13 102,874,223 (GRCm39) missense probably damaging 1.00
R7241:Mast4 UTSW 13 103,470,508 (GRCm39) missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102,874,986 (GRCm39) missense probably damaging 1.00
R7246:Mast4 UTSW 13 102,930,511 (GRCm39) missense probably damaging 1.00
R7332:Mast4 UTSW 13 102,887,932 (GRCm39) missense possibly damaging 0.61
R7453:Mast4 UTSW 13 102,941,149 (GRCm39) critical splice donor site probably null
R7514:Mast4 UTSW 13 102,923,934 (GRCm39) nonsense probably null
R7697:Mast4 UTSW 13 102,875,711 (GRCm39) missense probably damaging 1.00
R7820:Mast4 UTSW 13 102,890,596 (GRCm39) missense probably damaging 1.00
R7874:Mast4 UTSW 13 102,875,783 (GRCm39) missense probably damaging 1.00
R7933:Mast4 UTSW 13 102,909,071 (GRCm39) missense probably damaging 0.99
R8042:Mast4 UTSW 13 102,917,753 (GRCm39) missense probably damaging 0.96
R8060:Mast4 UTSW 13 102,874,184 (GRCm39) missense possibly damaging 0.89
R8172:Mast4 UTSW 13 103,089,633 (GRCm39) critical splice donor site probably null
R8206:Mast4 UTSW 13 102,872,247 (GRCm39) missense probably damaging 1.00
R8248:Mast4 UTSW 13 102,875,229 (GRCm39) missense probably damaging 1.00
R8283:Mast4 UTSW 13 102,895,177 (GRCm39) missense probably damaging 1.00
R8346:Mast4 UTSW 13 102,887,986 (GRCm39) missense probably damaging 0.99
R8434:Mast4 UTSW 13 102,897,900 (GRCm39) missense probably damaging 1.00
R8796:Mast4 UTSW 13 102,919,899 (GRCm39) missense probably benign 0.07
R8850:Mast4 UTSW 13 102,895,174 (GRCm39) missense probably damaging 1.00
R9012:Mast4 UTSW 13 102,934,606 (GRCm39) missense probably benign 0.05
R9375:Mast4 UTSW 13 102,917,753 (GRCm39) missense probably damaging 0.99
R9389:Mast4 UTSW 13 103,470,438 (GRCm39) missense probably benign 0.00
R9404:Mast4 UTSW 13 102,887,933 (GRCm39) missense probably damaging 1.00
R9520:Mast4 UTSW 13 102,925,532 (GRCm39) missense probably damaging 1.00
R9525:Mast4 UTSW 13 102,872,944 (GRCm39) missense probably benign 0.00
R9526:Mast4 UTSW 13 102,873,593 (GRCm39) missense probably benign 0.00
R9709:Mast4 UTSW 13 102,910,711 (GRCm39) missense probably damaging 1.00
R9790:Mast4 UTSW 13 102,890,705 (GRCm39) missense probably benign 0.01
R9791:Mast4 UTSW 13 102,890,705 (GRCm39) missense probably benign 0.01
RF005:Mast4 UTSW 13 102,872,815 (GRCm39) small insertion probably benign
RF015:Mast4 UTSW 13 102,875,755 (GRCm39) frame shift probably null
RF019:Mast4 UTSW 13 102,872,815 (GRCm39) small insertion probably benign
RF037:Mast4 UTSW 13 102,875,749 (GRCm39) small deletion probably benign
RF039:Mast4 UTSW 13 102,875,749 (GRCm39) small deletion probably benign
RF040:Mast4 UTSW 13 102,875,749 (GRCm39) small deletion probably benign
Z1088:Mast4 UTSW 13 102,875,027 (GRCm39) missense probably damaging 1.00
Z1176:Mast4 UTSW 13 102,874,968 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATCTTGCTAGGAAAGGCC -3'
(R):5'- AAGCCTTCCCTGAACTTCTGG -3'

Sequencing Primer
(F):5'- CAGTGAGTGTCCCAACAGTG -3'
(R):5'- GGATAAGGAGTTGACTTTCCCCAGAC -3'
Posted On 2014-09-17