Incidental Mutation 'R2060:Synj2'
ID 228663
Institutional Source Beutler Lab
Gene Symbol Synj2
Ensembl Gene ENSMUSG00000023805
Gene Name synaptojanin 2
Synonyms SJ2
MMRRC Submission 040065-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.120) question?
Stock # R2060 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 5991555-6094565 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6087755 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1269 (T1269A)
Ref Sequence ENSEMBL: ENSMUSP00000111457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061091] [ENSMUST00000080283] [ENSMUST00000097432] [ENSMUST00000115784] [ENSMUST00000115785] [ENSMUST00000115787] [ENSMUST00000115788] [ENSMUST00000115789] [ENSMUST00000115790] [ENSMUST00000115791] [ENSMUST00000154114] [ENSMUST00000134767] [ENSMUST00000126881]
AlphaFold Q9D2G5
Predicted Effect probably benign
Transcript: ENSMUST00000061091
SMART Domains Protein: ENSMUSP00000060382
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 263 2.5e-72 PFAM
Blast:IPPc 394 423 3e-6 BLAST
IPPc 443 785 3.72e-128 SMART
DUF1866 778 923 1.04e-73 SMART
low complexity region 926 940 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080283
AA Change: T1224A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000079164
Gene: ENSMUSG00000023805
AA Change: T1224A

DomainStartEndE-ValueType
Pfam:Syja_N 60 348 5.5e-78 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1167 1179 N/A INTRINSIC
low complexity region 1217 1234 N/A INTRINSIC
low complexity region 1263 1277 N/A INTRINSIC
low complexity region 1293 1306 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097432
SMART Domains Protein: ENSMUSP00000095043
Gene: ENSMUSG00000015659

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
SCOP:d1gw5a_ 89 464 3e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115784
SMART Domains Protein: ENSMUSP00000111450
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
PDB:3LWT|X 9 171 3e-12 PDB
Blast:IPPc 163 192 2e-6 BLAST
IPPc 212 554 3.72e-128 SMART
DUF1866 547 692 1.04e-73 SMART
low complexity region 695 709 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115785
AA Change: T908A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000111451
Gene: ENSMUSG00000023805
AA Change: T908A

DomainStartEndE-ValueType
PDB:3LWT|X 9 171 4e-12 PDB
Blast:IPPc 163 192 2e-6 BLAST
IPPc 212 554 3.72e-128 SMART
DUF1866 547 692 1.04e-73 SMART
low complexity region 695 709 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
low complexity region 851 863 N/A INTRINSIC
low complexity region 901 918 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
low complexity region 977 990 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115787
SMART Domains Protein: ENSMUSP00000111453
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 5.7e-28 PFAM
Blast:IPPc 239 268 2e-6 BLAST
IPPc 288 630 3.72e-128 SMART
DUF1866 623 768 1.04e-73 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 810 821 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
low complexity region 977 994 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115788
SMART Domains Protein: ENSMUSP00000111454
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 4.8e-28 PFAM
Blast:IPPc 239 268 2e-6 BLAST
IPPc 288 630 3.72e-128 SMART
DUF1866 623 768 1.04e-73 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 810 821 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115789
SMART Domains Protein: ENSMUSP00000111455
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 187 2.3e-60 PFAM
Blast:IPPc 318 347 2e-6 BLAST
IPPc 367 709 3.72e-128 SMART
DUF1866 702 847 1.04e-73 SMART
low complexity region 850 864 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 1006 1018 N/A INTRINSIC
low complexity region 1056 1073 N/A INTRINSIC
low complexity region 1102 1116 N/A INTRINSIC
low complexity region 1132 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115790
AA Change: T1184A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000111456
Gene: ENSMUSG00000023805
AA Change: T1184A

DomainStartEndE-ValueType
Pfam:Syja_N 1 263 3e-72 PFAM
Blast:IPPc 394 423 3e-6 BLAST
IPPc 443 785 3.72e-128 SMART
DUF1866 778 923 1.04e-73 SMART
low complexity region 926 940 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1177 1194 N/A INTRINSIC
low complexity region 1223 1237 N/A INTRINSIC
low complexity region 1253 1266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115791
AA Change: T1269A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000111457
Gene: ENSMUSG00000023805
AA Change: T1269A

DomainStartEndE-ValueType
Pfam:Syja_N 61 343 8.5e-67 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1097 1112 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1262 1279 N/A INTRINSIC
low complexity region 1308 1322 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154114
SMART Domains Protein: ENSMUSP00000122316
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
IPPc 6 348 3.72e-128 SMART
DUF1866 341 486 1.04e-73 SMART
low complexity region 489 503 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134767
Predicted Effect probably benign
Transcript: ENSMUST00000126881
SMART Domains Protein: ENSMUSP00000115371
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
DUF1866 16 161 1.04e-73 SMART
low complexity region 164 178 N/A INTRINSIC
low complexity region 203 214 N/A INTRINSIC
low complexity region 320 332 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the inositol-polyphosphate 5-phosphatase family. The encoded protein interacts with the ras-related C3 botulinum toxin substrate 1, which causes translocation of the encoded protein to the plasma membrane where it inhibits clathrin-mediated endocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for an ENU-induced allele show progressive hearing loss and cochlear hair cell degeneration associated with fusion of stereocilia followed by total loss of hair bundles and cochlear ganglion degeneration. No vestibular dysfunction or other behavioral deficits are observed. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 119,826,741 (GRCm39) W462* probably null Het
Aftph A T 11: 20,642,571 (GRCm39) Y821N probably damaging Het
Ahnak A T 19: 8,985,405 (GRCm39) M2230L probably benign Het
Arfgap1 T C 2: 180,614,575 (GRCm39) F144L probably benign Het
Arid4b C T 13: 14,370,037 (GRCm39) R1178C probably damaging Het
Asb8 A T 15: 98,039,254 (GRCm39) C49S possibly damaging Het
Baz1b A G 5: 135,233,968 (GRCm39) N165S probably damaging Het
Bod1l A T 5: 41,966,085 (GRCm39) I2660N possibly damaging Het
C2cd3 T C 7: 100,104,155 (GRCm39) I825T probably damaging Het
C4b A G 17: 34,955,075 (GRCm39) W804R probably damaging Het
Cadm3 A T 1: 173,171,969 (GRCm39) D201E probably damaging Het
Cdh17 T C 4: 11,803,982 (GRCm39) F552L probably benign Het
Cdh20 G C 1: 109,976,607 (GRCm39) A91P probably damaging Het
Cela1 A G 15: 100,573,203 (GRCm39) probably null Het
Clk3 T C 9: 57,658,400 (GRCm39) Y582C probably damaging Het
Cma1 C T 14: 56,181,155 (GRCm39) probably null Het
Ctcfl A G 2: 172,960,299 (GRCm39) S95P probably benign Het
Cylc1 C A X: 110,166,892 (GRCm39) T391K unknown Het
Cyp3a11 T A 5: 145,791,891 (GRCm39) I501L probably benign Het
Cyp3a59 T A 5: 146,041,524 (GRCm39) L356Q probably damaging Het
Dcdc2a A C 13: 25,291,693 (GRCm39) D226A possibly damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dlec1 A C 9: 118,941,154 (GRCm39) T235P probably damaging Het
Dnaaf1 G A 8: 120,317,341 (GRCm39) R290Q probably benign Het
Dnaaf5 C T 5: 139,163,758 (GRCm39) R377W probably damaging Het
Dpep1 T A 8: 123,927,130 (GRCm39) V293E probably damaging Het
Drosha T A 15: 12,924,245 (GRCm39) V1209E possibly damaging Het
Dync2h1 T G 9: 7,162,802 (GRCm39) I596L possibly damaging Het
Edem1 T A 6: 108,831,248 (GRCm39) Y570N probably damaging Het
Edrf1 G T 7: 133,258,858 (GRCm39) E9* probably null Het
Enpep T A 3: 129,074,172 (GRCm39) N792Y probably benign Het
Enpp2 A T 15: 54,739,110 (GRCm39) M391K probably damaging Het
Fanca A C 8: 124,001,220 (GRCm39) V1105G probably damaging Het
Fbxo22 T A 9: 55,125,667 (GRCm39) L74I probably damaging Het
Fchsd2 T A 7: 100,926,624 (GRCm39) F571L probably benign Het
Fhad1 T C 4: 141,626,560 (GRCm39) D1345G probably benign Het
G2e3 T C 12: 51,419,389 (GRCm39) F702L probably damaging Het
Glce A T 9: 61,968,228 (GRCm39) S308T possibly damaging Het
Glt1d1 A G 5: 127,734,183 (GRCm39) D119G probably benign Het
Gpr137c T C 14: 45,481,616 (GRCm39) I144T probably damaging Het
Gprin3 A G 6: 59,331,504 (GRCm39) C268R possibly damaging Het
Hadha G A 5: 30,333,834 (GRCm39) T395M probably benign Het
Hdhd2 T G 18: 77,052,738 (GRCm39) probably null Het
Homer2 C T 7: 81,268,451 (GRCm39) E70K probably benign Het
Hp1bp3 T A 4: 137,967,983 (GRCm39) D397E probably damaging Het
Hrh3 T C 2: 179,743,043 (GRCm39) N195S possibly damaging Het
Hyou1 T C 9: 44,292,849 (GRCm39) V153A probably benign Het
Igf2r A T 17: 12,920,206 (GRCm39) S1378T possibly damaging Het
Ints4 G A 7: 97,150,970 (GRCm39) R279H possibly damaging Het
Itga10 A T 3: 96,562,314 (GRCm39) R699* probably null Het
Itpkb A G 1: 180,249,423 (GRCm39) T933A probably benign Het
Itsn2 T G 12: 4,677,879 (GRCm39) F79V probably damaging Het
Jak3 C A 8: 72,133,358 (GRCm39) C350* probably null Het
Jak3 A T 8: 72,136,059 (GRCm39) K620* probably null Het
Kcnq5 T C 1: 21,531,821 (GRCm39) S421G probably benign Het
Kdm2b A T 5: 123,021,428 (GRCm39) M50K probably damaging Het
Klk1b1 A G 7: 43,620,047 (GRCm39) D170G possibly damaging Het
Lama3 A T 18: 12,661,783 (GRCm39) T2160S probably benign Het
Lman1 A T 18: 66,131,423 (GRCm39) probably benign Het
Lmtk3 G A 7: 45,450,335 (GRCm39) probably null Het
Ltb A G 17: 35,414,739 (GRCm39) R180G probably damaging Het
Ltbp4 C T 7: 27,008,378 (GRCm39) R1310Q probably damaging Het
Macf1 T A 4: 123,393,712 (GRCm39) probably null Het
Mast4 G T 13: 102,875,354 (GRCm39) P1146Q probably damaging Het
Micall2 C T 5: 139,697,317 (GRCm39) S678N probably damaging Het
Mon2 A T 10: 122,831,681 (GRCm39) I1675N probably damaging Het
Mug2 A G 6: 122,056,571 (GRCm39) N1172S probably benign Het
Naa30 C G 14: 49,410,556 (GRCm39) S161R possibly damaging Het
Ncaph T C 2: 126,966,795 (GRCm39) N220D probably damaging Het
Nell1 T C 7: 50,210,578 (GRCm39) V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 (GRCm38) N142S possibly damaging Het
Nin T A 12: 70,089,192 (GRCm39) T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 (GRCm38) noncoding transcript Het
Nrg1 T G 8: 32,408,043 (GRCm39) E63D probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or14j7 A G 17: 38,234,771 (GRCm39) T105A probably benign Het
Or5d39 T C 2: 87,979,487 (GRCm39) Y292C probably damaging Het
Or5g29 G A 2: 85,421,627 (GRCm39) V248I possibly damaging Het
Or5p53 C T 7: 107,532,868 (GRCm39) T47M probably benign Het
Or6ae1 T A 7: 139,742,737 (GRCm39) E42V probably damaging Het
Or7d11 A T 9: 19,965,892 (GRCm39) I289N probably damaging Het
Or7g27 A G 9: 19,250,352 (GRCm39) I199V probably benign Het
Or7g32 T A 9: 19,408,533 (GRCm39) V163E possibly damaging Het
Orc5 C T 5: 22,721,701 (GRCm39) probably null Het
Pard3 G A 8: 128,125,085 (GRCm39) R691Q probably benign Het
Pofut1 T A 2: 153,085,580 (GRCm39) D54E probably benign Het
Prl2c5 T A 13: 13,365,238 (GRCm39) V128E probably damaging Het
Ptk7 T C 17: 46,877,164 (GRCm39) M965V possibly damaging Het
Pum2 C T 12: 8,778,726 (GRCm39) R459* probably null Het
Pzp A T 6: 128,460,673 (GRCm39) N1494K probably benign Het
Rad21l A G 2: 151,487,349 (GRCm39) V545A probably benign Het
Rps6kc1 A T 1: 190,542,305 (GRCm39) M352K possibly damaging Het
Rpusd2 G A 2: 118,867,696 (GRCm39) probably null Het
Rsph14 A T 10: 74,865,603 (GRCm39) D78E probably damaging Het
Rtl9 A T X: 141,885,026 (GRCm39) M813L possibly damaging Het
Rtp4 A T 16: 23,431,690 (GRCm39) H74L probably damaging Het
Rusc1 G A 3: 88,995,155 (GRCm39) T725I possibly damaging Het
Rusf1 A G 7: 127,887,503 (GRCm39) L176P probably damaging Het
Ryr2 C T 13: 11,610,622 (GRCm39) C4068Y probably damaging Het
Ryr3 A G 2: 112,784,709 (GRCm39) V224A possibly damaging Het
Shprh A T 10: 11,027,864 (GRCm39) N157I probably benign Het
Siglece A G 7: 43,307,210 (GRCm39) I67T probably benign Het
Slc9b2 A T 3: 135,032,027 (GRCm39) T296S probably damaging Het
Sorbs2 A G 8: 46,228,666 (GRCm39) K276E probably damaging Het
Taar7b T C 10: 23,876,573 (GRCm39) I246T possibly damaging Het
Taldo1 A G 7: 140,976,067 (GRCm39) Y113C probably damaging Het
Tarbp1 A T 8: 127,174,333 (GRCm39) probably null Het
Tars1 C T 15: 11,394,459 (GRCm39) M59I probably benign Het
Tas2r130 G A 6: 131,607,780 (GRCm39) T5I probably benign Het
Tex48 T C 4: 63,525,652 (GRCm39) E77G probably damaging Het
Tmco5 A G 2: 116,722,736 (GRCm39) R286G probably damaging Het
Trdmt1 A T 2: 13,524,725 (GRCm39) H243Q probably benign Het
Ttn T A 2: 76,564,638 (GRCm39) R26754* probably null Het
Ttn G A 2: 76,727,924 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,791,358 (GRCm39) L244R probably damaging Het
Ubxn1 C T 19: 8,850,930 (GRCm39) R115* probably null Het
Umod T G 7: 119,075,938 (GRCm39) N276T probably damaging Het
Unc13c A T 9: 73,572,938 (GRCm39) L1528Q probably damaging Het
Unc80 T A 1: 66,679,754 (GRCm39) H2108Q possibly damaging Het
Utp20 A C 10: 88,610,657 (GRCm39) D1442E probably damaging Het
Utp4 A G 8: 107,625,153 (GRCm39) Q144R probably benign Het
Vmn2r17 T A 5: 109,575,075 (GRCm39) N127K probably benign Het
Vmn2r75 T A 7: 85,814,372 (GRCm39) T374S probably benign Het
Washc5 A G 15: 59,222,257 (GRCm39) F523L probably damaging Het
Wdr3 A T 3: 100,067,213 (GRCm39) probably null Het
Wdr89 T C 12: 75,679,762 (GRCm39) Y164C probably damaging Het
Xpo5 T C 17: 46,536,017 (GRCm39) S550P probably damaging Het
Zfp69 T C 4: 120,788,029 (GRCm39) T429A probably damaging Het
Zfpm1 G T 8: 123,063,331 (GRCm39) G797C probably benign Het
Other mutations in Synj2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Synj2 APN 17 6,088,201 (GRCm39) missense possibly damaging 0.48
IGL01399:Synj2 APN 17 6,060,046 (GRCm39) missense probably damaging 1.00
IGL01793:Synj2 APN 17 6,088,321 (GRCm39) missense probably benign 0.01
IGL01793:Synj2 APN 17 6,077,500 (GRCm39) nonsense probably null
IGL02096:Synj2 APN 17 6,040,628 (GRCm39) missense probably damaging 1.00
IGL02115:Synj2 APN 17 6,067,865 (GRCm39) missense probably damaging 1.00
IGL02222:Synj2 APN 17 6,087,755 (GRCm39) missense probably benign 0.04
IGL02478:Synj2 APN 17 6,088,199 (GRCm39) missense probably benign 0.00
IGL02634:Synj2 APN 17 6,080,035 (GRCm39) missense probably damaging 1.00
IGL02652:Synj2 APN 17 6,067,868 (GRCm39) missense probably damaging 1.00
IGL02681:Synj2 APN 17 6,040,611 (GRCm39) missense probably damaging 1.00
IGL02719:Synj2 APN 17 6,047,192 (GRCm39) missense probably benign 0.02
IGL03253:Synj2 APN 17 6,053,434 (GRCm39) splice site probably null
IGL03365:Synj2 APN 17 6,069,679 (GRCm39) missense probably damaging 1.00
I2288:Synj2 UTSW 17 6,072,542 (GRCm39) splice site probably benign
I2289:Synj2 UTSW 17 6,072,542 (GRCm39) splice site probably benign
R0389:Synj2 UTSW 17 6,080,058 (GRCm39) missense probably benign 0.35
R0433:Synj2 UTSW 17 6,084,123 (GRCm39) missense probably damaging 1.00
R0530:Synj2 UTSW 17 6,058,380 (GRCm39) missense possibly damaging 0.88
R0539:Synj2 UTSW 17 6,047,163 (GRCm39) start codon destroyed probably null 0.63
R0556:Synj2 UTSW 17 6,088,230 (GRCm39) nonsense probably null
R1263:Synj2 UTSW 17 6,069,634 (GRCm39) missense probably damaging 0.99
R1443:Synj2 UTSW 17 6,073,940 (GRCm39) missense probably damaging 0.99
R1450:Synj2 UTSW 17 6,077,599 (GRCm39) splice site probably benign
R1532:Synj2 UTSW 17 6,084,194 (GRCm39) missense probably benign 0.00
R1542:Synj2 UTSW 17 6,075,292 (GRCm39) missense probably benign 0.01
R1809:Synj2 UTSW 17 6,076,826 (GRCm39) missense possibly damaging 0.95
R1875:Synj2 UTSW 17 6,078,825 (GRCm39) missense possibly damaging 0.69
R1897:Synj2 UTSW 17 6,072,412 (GRCm39) nonsense probably null
R1928:Synj2 UTSW 17 6,040,542 (GRCm39) missense probably damaging 0.99
R2008:Synj2 UTSW 17 6,047,221 (GRCm39) missense probably damaging 1.00
R2109:Synj2 UTSW 17 6,063,966 (GRCm39) missense probably benign 0.00
R2332:Synj2 UTSW 17 6,074,069 (GRCm39) missense probably damaging 0.99
R2413:Synj2 UTSW 17 6,078,849 (GRCm39) missense probably damaging 1.00
R3684:Synj2 UTSW 17 6,078,718 (GRCm39) missense probably damaging 0.97
R4111:Synj2 UTSW 17 6,058,240 (GRCm39) missense probably benign 0.02
R4113:Synj2 UTSW 17 6,058,240 (GRCm39) missense probably benign 0.02
R4654:Synj2 UTSW 17 6,063,813 (GRCm39) missense probably damaging 1.00
R4797:Synj2 UTSW 17 6,084,163 (GRCm39) missense probably damaging 1.00
R4812:Synj2 UTSW 17 6,060,939 (GRCm39) missense probably damaging 1.00
R4873:Synj2 UTSW 17 6,038,343 (GRCm39) intron probably benign
R4875:Synj2 UTSW 17 6,038,343 (GRCm39) intron probably benign
R5110:Synj2 UTSW 17 6,087,990 (GRCm39) missense probably benign 0.06
R5205:Synj2 UTSW 17 5,991,793 (GRCm39) missense probably damaging 1.00
R5504:Synj2 UTSW 17 6,086,750 (GRCm39) missense possibly damaging 0.85
R5593:Synj2 UTSW 17 6,088,390 (GRCm39) makesense probably null
R5690:Synj2 UTSW 17 6,085,802 (GRCm39) missense probably benign 0.00
R5870:Synj2 UTSW 17 6,088,128 (GRCm39) missense probably benign 0.00
R6084:Synj2 UTSW 17 6,088,373 (GRCm39) missense probably damaging 1.00
R6084:Synj2 UTSW 17 6,067,889 (GRCm39) missense probably damaging 0.98
R6158:Synj2 UTSW 17 6,036,487 (GRCm39) missense probably benign 0.00
R6159:Synj2 UTSW 17 6,036,327 (GRCm39) missense probably damaging 1.00
R6160:Synj2 UTSW 17 6,058,336 (GRCm39) missense possibly damaging 0.92
R6278:Synj2 UTSW 17 6,026,149 (GRCm39) missense probably damaging 1.00
R6406:Synj2 UTSW 17 6,069,846 (GRCm39) intron probably benign
R6531:Synj2 UTSW 17 6,084,114 (GRCm39) missense probably damaging 1.00
R6729:Synj2 UTSW 17 6,036,289 (GRCm39) start codon destroyed probably null 1.00
R6774:Synj2 UTSW 17 6,088,290 (GRCm39) missense possibly damaging 0.87
R6792:Synj2 UTSW 17 6,040,565 (GRCm39) missense probably benign 0.01
R6844:Synj2 UTSW 17 6,026,081 (GRCm39) missense probably damaging 0.96
R6865:Synj2 UTSW 17 6,067,844 (GRCm39) nonsense probably null
R7178:Synj2 UTSW 17 6,076,754 (GRCm39) missense possibly damaging 0.95
R7286:Synj2 UTSW 17 6,088,220 (GRCm39) missense possibly damaging 0.79
R7403:Synj2 UTSW 17 6,088,005 (GRCm39) missense possibly damaging 0.76
R7451:Synj2 UTSW 17 6,080,066 (GRCm39) missense possibly damaging 0.68
R7501:Synj2 UTSW 17 6,040,514 (GRCm39) missense possibly damaging 0.79
R7730:Synj2 UTSW 17 6,066,562 (GRCm39) missense probably benign 0.33
R7799:Synj2 UTSW 17 6,088,098 (GRCm39) missense probably benign 0.10
R7804:Synj2 UTSW 17 6,069,809 (GRCm39) missense unknown
R7841:Synj2 UTSW 17 6,094,419 (GRCm39) missense unknown
R8347:Synj2 UTSW 17 6,060,060 (GRCm39) missense probably damaging 1.00
R8358:Synj2 UTSW 17 6,074,080 (GRCm39) nonsense probably null
R8391:Synj2 UTSW 17 5,991,796 (GRCm39) missense probably damaging 0.99
R8725:Synj2 UTSW 17 6,088,015 (GRCm39) missense possibly damaging 0.48
R8787:Synj2 UTSW 17 6,036,514 (GRCm39) missense possibly damaging 0.57
R8877:Synj2 UTSW 17 6,087,941 (GRCm39) missense probably damaging 1.00
R9091:Synj2 UTSW 17 6,067,875 (GRCm39) missense possibly damaging 0.88
R9121:Synj2 UTSW 17 6,040,599 (GRCm39) missense probably damaging 1.00
R9147:Synj2 UTSW 17 6,084,172 (GRCm39) missense probably damaging 1.00
R9148:Synj2 UTSW 17 6,084,172 (GRCm39) missense probably damaging 1.00
R9270:Synj2 UTSW 17 6,067,875 (GRCm39) missense possibly damaging 0.88
R9489:Synj2 UTSW 17 6,063,794 (GRCm39) missense probably benign 0.00
R9605:Synj2 UTSW 17 6,063,794 (GRCm39) missense probably benign 0.00
R9720:Synj2 UTSW 17 6,040,584 (GRCm39) missense probably benign
R9773:Synj2 UTSW 17 6,094,232 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATCTCAGAATGGCTGCCTCAG -3'
(R):5'- AGACTTCTTCCTCCTCGGAG -3'

Sequencing Primer
(F):5'- GTCTCTATTCCCTCCTGAGTGTTG -3'
(R):5'- TCCTCGGAGGCACCTTG -3'
Posted On 2014-09-17