Mutagenetix > Incidental Mutation

Incidental Mutation 'R2060:Igf2r'

228664

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

M6P/IGF2R, IGF-II/CI-MPR, Mpr300, CI-MPR, CD222, mannose-6-phosphate receptor, cation independent

MMRRC Submission

040065-MU

Accession Numbers

Genbank: NM_010515.2; Ensembl: ENSMUST00000024599, ENSMUST00000162982, ENSMUST00000159127

Essential gene?

Probably essential (E-score: 0.875) question?

Stock #

R2060 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12682406-12769664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12701319 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1378 (S1378T)

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

possibly damaging
Transcript: ENSMUST00000024599
AA Change: S1378T

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: S1378T

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161738

SMART Domains

Protein: ENSMUSP00000124664
Gene: ENSMUSG00000023830

Domain	Start	End	E-Value	Type
Pfam:CIMR	1	65	3.1e-24	PFAM
Pfam:CIMR	68	129	6.1e-15	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 129 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8430408G22Rik	G	A	6: 116,651,722	V9M	possibly damaging	Het
Abca14	G	A	7: 120,227,518	W462*	probably null	Het
Aftph	A	T	11: 20,692,571	Y821N	probably damaging	Het
Ahnak	A	T	19: 9,008,041	M2230L	probably benign	Het
Arfgap1	T	C	2: 180,972,782	F144L	probably benign	Het
Arid4b	C	T	13: 14,195,452	R1178C	probably damaging	Het
Asb8	A	T	15: 98,141,373	C49S	possibly damaging	Het
Baz1b	A	G	5: 135,205,114	N165S	probably damaging	Het
BC017158	A	G	7: 128,288,331	L176P	probably damaging	Het
Bod1l	A	T	5: 41,808,742	I2660N	possibly damaging	Het
C2cd3	T	C	7: 100,454,948	I825T	probably damaging	Het
C4b	A	G	17: 34,736,101	W804R	probably damaging	Het
Cadm3	A	T	1: 173,344,402	D201E	probably damaging	Het
Cdh17	T	C	4: 11,803,982	F552L	probably benign	Het
Cdh7	G	C	1: 110,048,877	A91P	probably damaging	Het
Cela1	A	G	15: 100,675,322		probably null	Het
Clk3	T	C	9: 57,751,117	Y582C	probably damaging	Het
Cma1	C	T	14: 55,943,698		probably null	Het
Ctcfl	A	G	2: 173,118,506	S95P	probably benign	Het
Cylc1	C	A	X: 111,123,123	T391K	unknown	Het
Cyp3a11	T	A	5: 145,855,081	I501L	probably benign	Het
Cyp3a59	T	A	5: 146,104,714	L356Q	probably damaging	Het
Dcdc2a	A	C	13: 25,107,710	D226A	possibly damaging	Het
Dlec1	A	C	9: 119,112,086	T235P	probably damaging	Het
Dnaaf1	G	A	8: 119,590,602	R290Q	probably benign	Het
Dnaaf5	C	T	5: 139,178,003	R377W	probably damaging	Het
Dpep1	T	A	8: 123,200,391	V293E	probably damaging	Het
Drosha	T	A	15: 12,924,159	V1209E	possibly damaging	Het
Dync2h1	T	G	9: 7,162,802	I596L	possibly damaging	Het
Edem1	T	A	6: 108,854,287	Y570N	probably damaging	Het
Edrf1	G	T	7: 133,657,129	E9*	probably null	Het
Enpep	T	A	3: 129,280,523	N792Y	probably benign	Het
Enpp2	A	T	15: 54,875,714	M391K	probably damaging	Het
Fanca	A	C	8: 123,274,481	V1105G	probably damaging	Het
Fbxo22	T	A	9: 55,218,383	L74I	probably damaging	Het
Fchsd2	T	A	7: 101,277,417	F571L	probably benign	Het
Fhad1	T	C	4: 141,899,249	D1345G	probably benign	Het
G2e3	T	C	12: 51,372,606	F702L	probably damaging	Het
Glce	A	T	9: 62,060,946	S308T	possibly damaging	Het
Glt1d1	A	G	5: 127,657,119	D119G	probably benign	Het
Gpr137c	T	C	14: 45,244,159	I144T	probably damaging	Het
Gprin3	A	G	6: 59,354,519	C268R	possibly damaging	Het
Hadha	G	A	5: 30,128,836	T395M	probably benign	Het
Hdhd2	T	G	18: 76,965,042		probably null	Het
Homer2	C	T	7: 81,618,703	E70K	probably benign	Het
Hp1bp3	T	A	4: 138,240,672	D397E	probably damaging	Het
Hrh3	T	C	2: 180,101,250	N195S	possibly damaging	Het
Hyou1	T	C	9: 44,381,552	V153A	probably benign	Het
Ints4	G	A	7: 97,501,763	R279H	possibly damaging	Het
Itga10	A	T	3: 96,654,998	R699*	probably null	Het
Itpkb	A	G	1: 180,421,858	T933A	probably benign	Het
Itsn2	T	G	12: 4,627,879	F79V	probably damaging	Het
Jak3	C	A	8: 71,680,714	C350*	probably null	Het
Jak3	A	T	8: 71,683,415	K620*	probably null	Het
Kcnq5	T	C	1: 21,461,597	S421G	probably benign	Het
Kdm2b	A	T	5: 122,883,365	M50K	probably damaging	Het
Klk1b1	A	G	7: 43,970,623	D170G	possibly damaging	Het
Lama3	A	T	18: 12,528,726	T2160S	probably benign	Het
Lman1	A	T	18: 65,998,352		probably benign	Het
Lmtk3	G	A	7: 45,800,911		probably null	Het
Ltb	A	G	17: 35,195,763	R180G	probably damaging	Het
Ltbp4	C	T	7: 27,308,953	R1310Q	probably damaging	Het
Macf1	T	A	4: 123,499,919		probably null	Het
Mast4	G	T	13: 102,738,846	P1146Q	probably damaging	Het
Micall2	C	T	5: 139,711,562	S678N	probably damaging	Het
Mon2	A	T	10: 122,995,776	I1675N	probably damaging	Het
Mug2	A	G	6: 122,079,612	N1172S	probably benign	Het
Naa30	C	G	14: 49,173,099	S161R	possibly damaging	Het
Ncaph	T	C	2: 127,124,875	N220D	probably damaging	Het
Nell1	T	C	7: 50,560,830	V497A	possibly damaging	Het
Ngly1	A	G	14: 16,277,877	N142S	possibly damaging	Het
Nin	T	A	12: 70,042,418	T1408S	possibly damaging	Het
Nlrp4g	T	A	9: 124,349,693		noncoding transcript	Het
Nrg1	T	G	8: 31,918,015	E63D	probably damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr1167	T	C	2: 88,149,143	Y292C	probably damaging	Het
Olfr128	A	G	17: 37,923,880	T105A	probably benign	Het
Olfr473	C	T	7: 107,933,661	T47M	probably benign	Het
Olfr522	T	A	7: 140,162,824	E42V	probably damaging	Het
Olfr845	A	G	9: 19,339,056	I199V	probably benign	Het
Olfr851	T	A	9: 19,497,237	V163E	possibly damaging	Het
Olfr867	A	T	9: 20,054,596	I289N	probably damaging	Het
Olfr998	G	A	2: 85,591,283	V248I	possibly damaging	Het
Orc5	C	T	5: 22,516,703		probably null	Het
Pard3	G	A	8: 127,398,604	R691Q	probably benign	Het
Pofut1	T	A	2: 153,243,660	D54E	probably benign	Het
Prl2c5	T	A	13: 13,190,653	V128E	probably damaging	Het
Ptk7	T	C	17: 46,566,238	M965V	possibly damaging	Het
Pum2	C	T	12: 8,728,726	R459*	probably null	Het
Pzp	A	T	6: 128,483,710	N1494K	probably benign	Het
Rad21l	A	G	2: 151,645,429	V545A	probably benign	Het
Rps6kc1	A	T	1: 190,810,108	M352K	possibly damaging	Het
Rpusd2	G	A	2: 119,037,215		probably null	Het
Rsph14	A	T	10: 75,029,771	D78E	probably damaging	Het
Rtl9	A	T	X: 143,102,030	M813L	possibly damaging	Het
Rtp4	A	T	16: 23,612,940	H74L	probably damaging	Het
Rusc1	G	A	3: 89,087,848	T725I	possibly damaging	Het
Ryr2	C	T	13: 11,595,736	C4068Y	probably damaging	Het
Ryr3	A	G	2: 112,954,364	V224A	possibly damaging	Het
Shprh	A	T	10: 11,152,120	N157I	probably benign	Het
Siglece	A	G	7: 43,657,786	I67T	probably benign	Het
Slc9b2	A	T	3: 135,326,266	T296S	probably damaging	Het
Sorbs2	A	G	8: 45,775,629	K276E	probably damaging	Het
Synj2	A	G	17: 6,037,480	T1269A	probably benign	Het
Taar7b	T	C	10: 24,000,675	I246T	possibly damaging	Het
Taldo1	A	G	7: 141,396,154	Y113C	probably damaging	Het
Tarbp1	A	T	8: 126,447,594		probably null	Het
Tars	C	T	15: 11,394,373	M59I	probably benign	Het
Tas2r130	G	A	6: 131,630,817	T5I	probably benign	Het
Tex48	T	C	4: 63,607,415	E77G	probably damaging	Het
Tmco5	A	G	2: 116,892,255	R286G	probably damaging	Het
Trdmt1	A	T	2: 13,519,914	H243Q	probably benign	Het
Ttn	T	A	2: 76,734,294	R26754*	probably null	Het
Ttn	G	A	2: 76,897,580		probably benign	Het
Ubqln3	A	C	7: 104,142,151	L244R	probably damaging	Het
Ubxn1	C	T	19: 8,873,566	R115*	probably null	Het
Umod	T	G	7: 119,476,715	N276T	probably damaging	Het
Unc13c	A	T	9: 73,665,656	L1528Q	probably damaging	Het
Unc80	T	A	1: 66,640,595	H2108Q	possibly damaging	Het
Utp20	A	C	10: 88,774,795	D1442E	probably damaging	Het
Utp4	A	G	8: 106,898,521	Q144R	probably benign	Het
Vmn2r17	T	A	5: 109,427,209	N127K	probably benign	Het
Vmn2r75	T	A	7: 86,165,164	T374S	probably benign	Het
Washc5	A	G	15: 59,350,408	F523L	probably damaging	Het
Wdr3	A	T	3: 100,159,897		probably null	Het
Wdr89	T	C	12: 75,632,988	Y164C	probably damaging	Het
Xpo5	T	C	17: 46,225,091	S550P	probably damaging	Het
Zfp69	T	C	4: 120,930,832	T429A	probably damaging	Het
Zfpm1	G	T	8: 122,336,592	G797C	probably benign	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12713990	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12739328	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12700358	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12683867	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12704775	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12695374	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12704349	missense	probably benign
IGL01557:Igf2r	APN	17	12704635	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12683985	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12725415	nonsense	probably null
IGL01720:Igf2r	APN	17	12701313	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12683822	missense	probably benign
IGL01839:Igf2r	APN	17	12705022	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12714911	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12704338	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12693192	nonsense	probably null
IGL02095:Igf2r	APN	17	12702005	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12698516	unclassified	probably benign
IGL02576:Igf2r	APN	17	12748763	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12712087	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12719883	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12692723	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12694120	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12710746	splice site	probably benign
IGL03080:Igf2r	APN	17	12726676	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12716672	missense	probably damaging	1.00
blunt	UTSW	17	12722175	missense	probably benign	0.02
brusque	UTSW	17	12714951	missense	probably damaging	0.98
gruff	UTSW	17	12684097	missense	probably damaging	0.96
outlier	UTSW	17	12695314	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12691962	missense	probably benign
R0165:Igf2r	UTSW	17	12698527	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12683948	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12692064	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12717274	splice site	probably null
R0722:Igf2r	UTSW	17	12715495	critical splice acceptor site	probably null
R0894:Igf2r	UTSW	17	12692101	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12694124	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12717269	splice site	probably benign
R1485:Igf2r	UTSW	17	12691285	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12726309	missense	probably benign
R1693:Igf2r	UTSW	17	12704316	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12697441	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12704270	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12733903	nonsense	probably null
R1994:Igf2r	UTSW	17	12692738	missense	probably benign
R2108:Igf2r	UTSW	17	12698251	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12722208	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12715943	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12722311	splice site	probably null
R2696:Igf2r	UTSW	17	12695344	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12686724	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12709468	missense	probably benign
R3930:Igf2r	UTSW	17	12705829	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12748751	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12702254	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12709511	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12703465	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12684126	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12684097	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12701353	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12691877	splice site	probably null
R4980:Igf2r	UTSW	17	12703360	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12725416	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12695314	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12693145	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12739334	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12717367	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12698352	splice site	probably null
R5794:Igf2r	UTSW	17	12709445	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12714951	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12714113	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12683900	missense	probably benign
R6396:Igf2r	UTSW	17	12714090	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12701250	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12691937	nonsense	probably null
R6591:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12698618	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12691937	nonsense	probably null
R6691:Igf2r	UTSW	17	12689008	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12714944	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12714082	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12703376	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12697341	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12718718	missense	probably benign
R7030:Igf2r	UTSW	17	12733866	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12698325	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12704323	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12714116	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12703484	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12698228	nonsense	probably null
R7463:Igf2r	UTSW	17	12710645	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12698273	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12735991	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12739369	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12748704	missense	probably benign
R8022:Igf2r	UTSW	17	12718795	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12701238	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12692071	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12733860	missense	probably benign
R8359:Igf2r	UTSW	17	12683861	missense	probably benign
R8500:Igf2r	UTSW	17	12709441	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12704313	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12701244	missense	probably damaging	0.97
R8933:Igf2r	UTSW	17	12704637	missense	probably damaging	1.00
R8976:Igf2r	UTSW	17	12726772	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12716650	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12751293	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12691213	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12739351	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12695353	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12722175	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12705759	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12698328	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12686754	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12694140	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12726701	missense	probably benign
X0028:Igf2r	UTSW	17	12704913	nonsense	probably null
Z1177:Igf2r	UTSW	17	12697399	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAAACTCCTTCCACTGAGGC -3'
(R):5'- GGACTCATCAAAGCTCAAGGC -3'

Sequencing Primer
(F):5'- AGGCCTCTCCTGCTCTG -3'
(R):5'- GCTCACTCTGCATTTGGAAAG -3'

Posted On

2014-09-17