Incidental Mutation 'R2060:Ltb'
ID 228667
Institutional Source Beutler Lab
Gene Symbol Ltb
Ensembl Gene ENSMUSG00000024399
Gene Name lymphotoxin B
Synonyms p33, Tnfc, lymphotoxin beta, LTbeta, Tnfsf3
MMRRC Submission 040065-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R2060 (G1)
Quality Score 206
Status Not validated
Chromosome 17
Chromosomal Location 35413483-35415281 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35414739 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 180 (R180G)
Ref Sequence ENSEMBL: ENSMUSP00000025262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025262] [ENSMUST00000025263] [ENSMUST00000167924] [ENSMUST00000173600]
AlphaFold P41155
Predicted Effect probably damaging
Transcript: ENSMUST00000025262
AA Change: R180G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025262
Gene: ENSMUSG00000024399
AA Change: R180G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
TNF 154 305 8.76e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025263
SMART Domains Protein: ENSMUSP00000025263
Gene: ENSMUSG00000024401

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 91 235 1.59e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167924
SMART Domains Protein: ENSMUSP00000126122
Gene: ENSMUSG00000024401

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 74 219 2.8e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173510
Predicted Effect probably damaging
Transcript: ENSMUST00000173600
AA Change: R59G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134706
Gene: ENSMUSG00000024399
AA Change: R59G

DomainStartEndE-ValueType
TNF 33 184 8.76e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183646
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lymphotoxin beta is a type II membrane protein of the TNF family. It anchors lymphotoxin-alpha to the cell surface through heterotrimer formation. The predominant form on the lymphocyte surface is the lymphotoxin-alpha 1/beta 2 complex (e.g. 1 molecule alpha/2 molecules beta) and this complex is the primary ligand for the lymphotoxin-beta receptor. The minor complex is lymphotoxin-alpha 2/beta 1. LTB is an inducer of the inflammatory response system and involved in normal development of lymphoid tissue. Lymphotoxin-beta isoform b is unable to complex with lymphotoxin-alpha suggesting a function for lymphotoxin-beta which is independent of lympyhotoxin-alpha. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations lack peripheral lymph nodes, Peyer's patches, splenic germinal centers and follicular dendritic cells. Mutants exhibit lymphocytosis in the circulation and peritoneal cavity with infiltrations of the lung and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 119,826,741 (GRCm39) W462* probably null Het
Aftph A T 11: 20,642,571 (GRCm39) Y821N probably damaging Het
Ahnak A T 19: 8,985,405 (GRCm39) M2230L probably benign Het
Arfgap1 T C 2: 180,614,575 (GRCm39) F144L probably benign Het
Arid4b C T 13: 14,370,037 (GRCm39) R1178C probably damaging Het
Asb8 A T 15: 98,039,254 (GRCm39) C49S possibly damaging Het
Baz1b A G 5: 135,233,968 (GRCm39) N165S probably damaging Het
Bod1l A T 5: 41,966,085 (GRCm39) I2660N possibly damaging Het
C2cd3 T C 7: 100,104,155 (GRCm39) I825T probably damaging Het
C4b A G 17: 34,955,075 (GRCm39) W804R probably damaging Het
Cadm3 A T 1: 173,171,969 (GRCm39) D201E probably damaging Het
Cdh17 T C 4: 11,803,982 (GRCm39) F552L probably benign Het
Cdh20 G C 1: 109,976,607 (GRCm39) A91P probably damaging Het
Cela1 A G 15: 100,573,203 (GRCm39) probably null Het
Clk3 T C 9: 57,658,400 (GRCm39) Y582C probably damaging Het
Cma1 C T 14: 56,181,155 (GRCm39) probably null Het
Ctcfl A G 2: 172,960,299 (GRCm39) S95P probably benign Het
Cylc1 C A X: 110,166,892 (GRCm39) T391K unknown Het
Cyp3a11 T A 5: 145,791,891 (GRCm39) I501L probably benign Het
Cyp3a59 T A 5: 146,041,524 (GRCm39) L356Q probably damaging Het
Dcdc2a A C 13: 25,291,693 (GRCm39) D226A possibly damaging Het
Depp1 G A 6: 116,628,683 (GRCm39) V9M possibly damaging Het
Dlec1 A C 9: 118,941,154 (GRCm39) T235P probably damaging Het
Dnaaf1 G A 8: 120,317,341 (GRCm39) R290Q probably benign Het
Dnaaf5 C T 5: 139,163,758 (GRCm39) R377W probably damaging Het
Dpep1 T A 8: 123,927,130 (GRCm39) V293E probably damaging Het
Drosha T A 15: 12,924,245 (GRCm39) V1209E possibly damaging Het
Dync2h1 T G 9: 7,162,802 (GRCm39) I596L possibly damaging Het
Edem1 T A 6: 108,831,248 (GRCm39) Y570N probably damaging Het
Edrf1 G T 7: 133,258,858 (GRCm39) E9* probably null Het
Enpep T A 3: 129,074,172 (GRCm39) N792Y probably benign Het
Enpp2 A T 15: 54,739,110 (GRCm39) M391K probably damaging Het
Fanca A C 8: 124,001,220 (GRCm39) V1105G probably damaging Het
Fbxo22 T A 9: 55,125,667 (GRCm39) L74I probably damaging Het
Fchsd2 T A 7: 100,926,624 (GRCm39) F571L probably benign Het
Fhad1 T C 4: 141,626,560 (GRCm39) D1345G probably benign Het
G2e3 T C 12: 51,419,389 (GRCm39) F702L probably damaging Het
Glce A T 9: 61,968,228 (GRCm39) S308T possibly damaging Het
Glt1d1 A G 5: 127,734,183 (GRCm39) D119G probably benign Het
Gpr137c T C 14: 45,481,616 (GRCm39) I144T probably damaging Het
Gprin3 A G 6: 59,331,504 (GRCm39) C268R possibly damaging Het
Hadha G A 5: 30,333,834 (GRCm39) T395M probably benign Het
Hdhd2 T G 18: 77,052,738 (GRCm39) probably null Het
Homer2 C T 7: 81,268,451 (GRCm39) E70K probably benign Het
Hp1bp3 T A 4: 137,967,983 (GRCm39) D397E probably damaging Het
Hrh3 T C 2: 179,743,043 (GRCm39) N195S possibly damaging Het
Hyou1 T C 9: 44,292,849 (GRCm39) V153A probably benign Het
Igf2r A T 17: 12,920,206 (GRCm39) S1378T possibly damaging Het
Ints4 G A 7: 97,150,970 (GRCm39) R279H possibly damaging Het
Itga10 A T 3: 96,562,314 (GRCm39) R699* probably null Het
Itpkb A G 1: 180,249,423 (GRCm39) T933A probably benign Het
Itsn2 T G 12: 4,677,879 (GRCm39) F79V probably damaging Het
Jak3 C A 8: 72,133,358 (GRCm39) C350* probably null Het
Jak3 A T 8: 72,136,059 (GRCm39) K620* probably null Het
Kcnq5 T C 1: 21,531,821 (GRCm39) S421G probably benign Het
Kdm2b A T 5: 123,021,428 (GRCm39) M50K probably damaging Het
Klk1b1 A G 7: 43,620,047 (GRCm39) D170G possibly damaging Het
Lama3 A T 18: 12,661,783 (GRCm39) T2160S probably benign Het
Lman1 A T 18: 66,131,423 (GRCm39) probably benign Het
Lmtk3 G A 7: 45,450,335 (GRCm39) probably null Het
Ltbp4 C T 7: 27,008,378 (GRCm39) R1310Q probably damaging Het
Macf1 T A 4: 123,393,712 (GRCm39) probably null Het
Mast4 G T 13: 102,875,354 (GRCm39) P1146Q probably damaging Het
Micall2 C T 5: 139,697,317 (GRCm39) S678N probably damaging Het
Mon2 A T 10: 122,831,681 (GRCm39) I1675N probably damaging Het
Mug2 A G 6: 122,056,571 (GRCm39) N1172S probably benign Het
Naa30 C G 14: 49,410,556 (GRCm39) S161R possibly damaging Het
Ncaph T C 2: 126,966,795 (GRCm39) N220D probably damaging Het
Nell1 T C 7: 50,210,578 (GRCm39) V497A possibly damaging Het
Ngly1 A G 14: 16,277,877 (GRCm38) N142S possibly damaging Het
Nin T A 12: 70,089,192 (GRCm39) T1408S possibly damaging Het
Nlrp4g T A 9: 124,349,693 (GRCm38) noncoding transcript Het
Nrg1 T G 8: 32,408,043 (GRCm39) E63D probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or14j7 A G 17: 38,234,771 (GRCm39) T105A probably benign Het
Or5d39 T C 2: 87,979,487 (GRCm39) Y292C probably damaging Het
Or5g29 G A 2: 85,421,627 (GRCm39) V248I possibly damaging Het
Or5p53 C T 7: 107,532,868 (GRCm39) T47M probably benign Het
Or6ae1 T A 7: 139,742,737 (GRCm39) E42V probably damaging Het
Or7d11 A T 9: 19,965,892 (GRCm39) I289N probably damaging Het
Or7g27 A G 9: 19,250,352 (GRCm39) I199V probably benign Het
Or7g32 T A 9: 19,408,533 (GRCm39) V163E possibly damaging Het
Orc5 C T 5: 22,721,701 (GRCm39) probably null Het
Pard3 G A 8: 128,125,085 (GRCm39) R691Q probably benign Het
Pofut1 T A 2: 153,085,580 (GRCm39) D54E probably benign Het
Prl2c5 T A 13: 13,365,238 (GRCm39) V128E probably damaging Het
Ptk7 T C 17: 46,877,164 (GRCm39) M965V possibly damaging Het
Pum2 C T 12: 8,778,726 (GRCm39) R459* probably null Het
Pzp A T 6: 128,460,673 (GRCm39) N1494K probably benign Het
Rad21l A G 2: 151,487,349 (GRCm39) V545A probably benign Het
Rps6kc1 A T 1: 190,542,305 (GRCm39) M352K possibly damaging Het
Rpusd2 G A 2: 118,867,696 (GRCm39) probably null Het
Rsph14 A T 10: 74,865,603 (GRCm39) D78E probably damaging Het
Rtl9 A T X: 141,885,026 (GRCm39) M813L possibly damaging Het
Rtp4 A T 16: 23,431,690 (GRCm39) H74L probably damaging Het
Rusc1 G A 3: 88,995,155 (GRCm39) T725I possibly damaging Het
Rusf1 A G 7: 127,887,503 (GRCm39) L176P probably damaging Het
Ryr2 C T 13: 11,610,622 (GRCm39) C4068Y probably damaging Het
Ryr3 A G 2: 112,784,709 (GRCm39) V224A possibly damaging Het
Shprh A T 10: 11,027,864 (GRCm39) N157I probably benign Het
Siglece A G 7: 43,307,210 (GRCm39) I67T probably benign Het
Slc9b2 A T 3: 135,032,027 (GRCm39) T296S probably damaging Het
Sorbs2 A G 8: 46,228,666 (GRCm39) K276E probably damaging Het
Synj2 A G 17: 6,087,755 (GRCm39) T1269A probably benign Het
Taar7b T C 10: 23,876,573 (GRCm39) I246T possibly damaging Het
Taldo1 A G 7: 140,976,067 (GRCm39) Y113C probably damaging Het
Tarbp1 A T 8: 127,174,333 (GRCm39) probably null Het
Tars1 C T 15: 11,394,459 (GRCm39) M59I probably benign Het
Tas2r130 G A 6: 131,607,780 (GRCm39) T5I probably benign Het
Tex48 T C 4: 63,525,652 (GRCm39) E77G probably damaging Het
Tmco5 A G 2: 116,722,736 (GRCm39) R286G probably damaging Het
Trdmt1 A T 2: 13,524,725 (GRCm39) H243Q probably benign Het
Ttn T A 2: 76,564,638 (GRCm39) R26754* probably null Het
Ttn G A 2: 76,727,924 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,791,358 (GRCm39) L244R probably damaging Het
Ubxn1 C T 19: 8,850,930 (GRCm39) R115* probably null Het
Umod T G 7: 119,075,938 (GRCm39) N276T probably damaging Het
Unc13c A T 9: 73,572,938 (GRCm39) L1528Q probably damaging Het
Unc80 T A 1: 66,679,754 (GRCm39) H2108Q possibly damaging Het
Utp20 A C 10: 88,610,657 (GRCm39) D1442E probably damaging Het
Utp4 A G 8: 107,625,153 (GRCm39) Q144R probably benign Het
Vmn2r17 T A 5: 109,575,075 (GRCm39) N127K probably benign Het
Vmn2r75 T A 7: 85,814,372 (GRCm39) T374S probably benign Het
Washc5 A G 15: 59,222,257 (GRCm39) F523L probably damaging Het
Wdr3 A T 3: 100,067,213 (GRCm39) probably null Het
Wdr89 T C 12: 75,679,762 (GRCm39) Y164C probably damaging Het
Xpo5 T C 17: 46,536,017 (GRCm39) S550P probably damaging Het
Zfp69 T C 4: 120,788,029 (GRCm39) T429A probably damaging Het
Zfpm1 G T 8: 123,063,331 (GRCm39) G797C probably benign Het
Other mutations in Ltb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Ltb APN 17 35,413,642 (GRCm39) missense possibly damaging 0.78
IGL01112:Ltb APN 17 35,413,576 (GRCm39) missense probably benign 0.04
IGL02263:Ltb APN 17 35,414,977 (GRCm39) missense probably damaging 1.00
IGL02983:Ltb APN 17 35,413,646 (GRCm39) missense probably benign 0.15
IGL02995:Ltb APN 17 35,414,348 (GRCm39) splice site probably benign
IGL03389:Ltb APN 17 35,414,044 (GRCm39) missense probably benign 0.00
R0103:Ltb UTSW 17 35,414,016 (GRCm39) intron probably benign
R0103:Ltb UTSW 17 35,414,016 (GRCm39) intron probably benign
R4718:Ltb UTSW 17 35,414,313 (GRCm39) splice site probably null
R4823:Ltb UTSW 17 35,414,206 (GRCm39) missense probably benign
R4884:Ltb UTSW 17 35,414,234 (GRCm39) missense probably benign
R5231:Ltb UTSW 17 35,414,802 (GRCm39) missense probably damaging 1.00
R5327:Ltb UTSW 17 35,414,935 (GRCm39) missense probably damaging 1.00
R8297:Ltb UTSW 17 35,413,655 (GRCm39) missense probably benign 0.00
R8344:Ltb UTSW 17 35,414,169 (GRCm39) missense probably benign 0.41
R9778:Ltb UTSW 17 35,414,906 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCGCTAAGTACCACAGAAGGAG -3'
(R):5'- GTGTACCATAACGACCCGTAC -3'

Sequencing Primer
(F):5'- AAGGAGGAAGACCCCGCTC -3'
(R):5'- TAACGACCCGTACCCGATGG -3'
Posted On 2014-09-17