Incidental Mutation 'R0153:Tfcp2'
ID22869
Institutional Source Beutler Lab
Gene Symbol Tfcp2
Ensembl Gene ENSMUSG00000009733
Gene Nametranscription factor CP2
SynonymsTcfcp2, CP-2, D230015P20Rik, LBP1, UBP-1, CP2, LSF, LBP-1c, LBP-1d
MMRRC Submission 038436-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0153 (G1)
Quality Score225
Status Validated (trace)
Chromosome15
Chromosomal Location100498012-100552008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 100514827 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 315 (E315Q)
Ref Sequence ENSEMBL: ENSMUSP00000155683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009877] [ENSMUST00000229581] [ENSMUST00000229696]
Predicted Effect probably damaging
Transcript: ENSMUST00000009877
AA Change: E315Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000009877
Gene: ENSMUSG00000009733
AA Change: E315Q

DomainStartEndE-ValueType
Pfam:CP2 44 260 8.6e-60 PFAM
low complexity region 287 302 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000229581
AA Change: E315Q

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000229696
AA Change: E315Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230363
Predicted Effect probably benign
Transcript: ENSMUST00000231174
Meta Mutation Damage Score 0.1513 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that binds the alpha-globin promoter and activates transcription of the alpha-globin gene. The encoded protein regulates erythroid gene expression, plays a role in the transcriptional switch of globin gene promoters, and it activates many other cellular and viral gene promoters. The gene product interacts with certain inflammatory response factors, and polymorphisms of this gene may be involved in the pathogenesis of Alzheimer's disease. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal with no apparent alterations in overall behavior, hematopoiesis, globin chain synthesis, or immunological function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik G T 9: 94,524,480 D291E probably benign Het
2010300C02Rik A G 1: 37,624,639 V726A probably benign Het
Abcb9 T C 5: 124,080,056 M406V probably benign Het
Adar T C 3: 89,730,814 S2P probably benign Het
Adgre1 T A 17: 57,443,939 S538T possibly damaging Het
Alms1 T A 6: 85,641,381 I2803N possibly damaging Het
Amn1 G T 6: 149,188,593 probably benign Het
Arid1b G A 17: 5,342,932 A2246T probably damaging Het
BC024139 T C 15: 76,121,747 E418G probably damaging Het
Bok A G 1: 93,686,517 D24G probably damaging Het
Cabp2 T C 19: 4,084,913 probably benign Het
Ccdc141 C A 2: 77,165,238 probably benign Het
Ccdc178 T C 18: 22,150,435 T13A probably benign Het
Ccdc42 G T 11: 68,587,650 V33F possibly damaging Het
Clcn7 G A 17: 25,149,202 probably benign Het
Cluh A G 11: 74,657,350 probably benign Het
Cr1l A T 1: 195,114,856 probably benign Het
Csnk1g3 T A 18: 53,918,789 probably benign Het
Depdc5 T C 5: 32,933,937 probably benign Het
Dgkh A C 14: 78,570,129 Y1149* probably null Het
Dnaic1 A G 4: 41,635,162 probably benign Het
Efcab2 A G 1: 178,474,886 E65G possibly damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam71e2 A T 7: 4,770,287 L177Q probably damaging Het
Fgfr4 A G 13: 55,161,385 probably benign Het
Gm10720 A C 9: 3,015,787 S44R probably null Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm6471 A T 7: 142,831,631 noncoding transcript Het
Gm8994 A T 6: 136,328,844 D101V probably damaging Het
Hnrnpm C T 17: 33,646,515 R724Q probably damaging Het
Homer1 C T 13: 93,391,746 T117I possibly damaging Het
Hoxd4 A T 2: 74,727,457 Q60L probably damaging Het
Ift172 T C 5: 31,260,624 R1274G probably benign Het
Ino80d A G 1: 63,058,318 S806P probably damaging Het
Itga10 T C 3: 96,653,700 V627A probably benign Het
Itgb2l A G 16: 96,437,369 Y77H possibly damaging Het
Kel A T 6: 41,701,943 H195Q probably benign Het
Klhdc7a A G 4: 139,967,271 S122P possibly damaging Het
Krt71 T A 15: 101,734,706 I456F possibly damaging Het
Lats1 T A 10: 7,691,575 S37T probably damaging Het
Lrp1b T A 2: 41,123,019 H1858L possibly damaging Het
Matk A T 10: 81,262,842 T461S probably benign Het
Meikin A G 11: 54,409,642 probably benign Het
Muc6 T C 7: 141,634,116 Q2832R possibly damaging Het
Myo10 T C 15: 25,781,238 F194L possibly damaging Het
Nbas G A 12: 13,273,876 probably benign Het
Nme4 A G 17: 26,093,857 probably null Het
Olfr1136 A G 2: 87,693,604 S93P probably benign Het
Olfr1217 T A 2: 89,023,196 N269I probably benign Het
Olfr1340 A T 4: 118,726,333 I29F possibly damaging Het
Olfr851 T A 9: 19,496,937 L63H probably damaging Het
Olfr954 T C 9: 39,461,671 V80A probably damaging Het
Pacsin2 T C 15: 83,377,661 Q473R probably benign Het
Patz1 A G 11: 3,293,288 H427R probably damaging Het
Pkp3 A G 7: 141,083,343 Y367C probably damaging Het
Prdm2 G A 4: 143,133,768 P984L possibly damaging Het
Rev3l T A 10: 39,874,128 C3091* probably null Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rpl5 T C 5: 107,904,757 F140L probably benign Het
Sec24a A C 11: 51,700,826 I1014M probably benign Het
Serpinb11 A G 1: 107,372,203 H93R probably benign Het
Shank2 C A 7: 144,070,135 H286N probably benign Het
Sipa1l2 G T 8: 125,421,898 Q1651K probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc30a5 A T 13: 100,826,494 F75L possibly damaging Het
Slco1a1 G T 6: 141,910,701 probably benign Het
Smg5 C T 3: 88,353,872 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Taf8 A T 17: 47,498,252 probably benign Het
Tarsl2 A G 7: 65,684,081 D617G probably damaging Het
Tbc1d5 A T 17: 50,984,687 probably benign Het
Tmf1 A T 6: 97,170,384 S540R probably damaging Het
Tmprss4 T C 9: 45,184,336 Q70R probably benign Het
Trip13 G T 13: 73,920,064 A266E possibly damaging Het
Ttc24 T A 3: 88,074,927 probably benign Het
Ttll5 T A 12: 85,831,966 I49N probably damaging Het
Ube2ql1 A T 13: 69,738,592 M250K possibly damaging Het
Vmn1r87 A T 7: 13,132,284 D25E probably damaging Het
Vmn2r84 A G 10: 130,392,008 Y120H probably benign Het
Wdr6 G A 9: 108,575,242 R481C probably damaging Het
Wdr60 A G 12: 116,232,636 V497A probably benign Het
Zcchc6 G A 13: 59,782,336 R962* probably null Het
Zdhhc17 A T 10: 110,955,094 Y371* probably null Het
Zfp292 T C 4: 34,811,185 N620D probably benign Het
Zfp932 T A 5: 110,006,968 Y11N probably benign Het
Other mutations in Tfcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Tfcp2 APN 15 100513178 unclassified probably benign
IGL00916:Tfcp2 APN 15 100520678 missense probably damaging 1.00
IGL01819:Tfcp2 APN 15 100504439 missense probably benign 0.02
IGL02075:Tfcp2 APN 15 100513180 unclassified probably benign
IGL02370:Tfcp2 APN 15 100512304 missense probably damaging 1.00
IGL02608:Tfcp2 APN 15 100514110 missense possibly damaging 0.48
IGL03001:Tfcp2 APN 15 100528421 missense possibly damaging 0.47
R2879:Tfcp2 UTSW 15 100551320 unclassified probably null
R3103:Tfcp2 UTSW 15 100525600 missense probably damaging 1.00
R4302:Tfcp2 UTSW 15 100514849 missense possibly damaging 0.77
R4929:Tfcp2 UTSW 15 100528489 missense probably benign 0.29
R4965:Tfcp2 UTSW 15 100525650 missense probably damaging 1.00
R5196:Tfcp2 UTSW 15 100520714 missense probably damaging 1.00
R5407:Tfcp2 UTSW 15 100527874 splice site probably null
R6091:Tfcp2 UTSW 15 100512313 missense probably damaging 1.00
R6136:Tfcp2 UTSW 15 100512313 missense probably damaging 1.00
R7241:Tfcp2 UTSW 15 100518587 missense possibly damaging 0.95
R7808:Tfcp2 UTSW 15 100522429 missense probably damaging 1.00
X0011:Tfcp2 UTSW 15 100513080 critical splice donor site probably null
X0040:Tfcp2 UTSW 15 100518598 missense probably damaging 1.00
X0063:Tfcp2 UTSW 15 100512301 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGGTATGTGAGAAACCACACTA -3'
(R):5'- ACTGTGTCGGAGAAGAGTGTTTTCAGA -3'

Sequencing Primer
(F):5'- aggtgaggcggagatgg -3'
(R):5'- AGTGTTTTCAGAGGAAGTAGAGATTC -3'
Posted On2013-04-16