Mutagenetix > Incidental Mutations

Incidental Mutation 'R2062:Pth2r'

228730

Institutional Source

Beutler Lab

Gene Symbol

Pth2r

Ensembl Gene

ENSMUSG00000025946

Gene Name

parathyroid hormone 2 receptor

Synonyms

Pthr2

MMRRC Submission

040067-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2062 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65282056-65389244 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65343562 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 158 (I158T)

Ref Sequence

ENSEMBL: ENSMUSP00000114594 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027083] [ENSMUST00000140190]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027083
AA Change: I163T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027083
Gene: ENSMUSG00000025946
AA Change: I163T

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
HormR	59	134	8.15e-28	SMART
Pfam:7tm_2	139	406	5.1e-81	PFAM
low complexity region	447	461	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000140190
AA Change: I158T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114594
Gene: ENSMUSG00000025946
AA Change: I158T

Domain	Start	End	E-Value	Type
HormR	54	129	8.15e-28	SMART
Pfam:7tm_2	134	174	1.1e-13	PFAM

Meta Mutation Damage Score

0.6722

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor 2 family. This protein is a receptor for parathyroid hormone (PTH). This receptor is more selective in ligand recognition and has a more specific tissue distribution compared to parathyroid hormone receptor 1 (PTHR1). It is activated only by PTH and not by parathyroid hormone-like hormone (PTHLH) and is particularly abundant in brain and pancreas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933436I01Rik	T	A	X: 67,920,702	I184L	probably benign	Het
A2ml1	A	T	6: 128,552,308	M957K	probably benign	Het
Adam7	C	A	14: 68,505,161	V668F	probably benign	Het
Adcy7	T	G	8: 88,312,274	L306R	probably damaging	Het
Akt3	A	G	1: 177,102,985	S136P	possibly damaging	Het
Alox12e	G	A	11: 70,316,002	R620W	probably damaging	Het
Amy2a1	T	C	3: 113,530,568	I108V	probably benign	Het
Ano7	T	C	1: 93,390,313	V249A	probably benign	Het
Aox1	T	C	1: 58,059,192		probably null	Het
Asah2	A	T	19: 32,024,874	V290E	probably damaging	Het
Ascc2	A	T	11: 4,681,496	M646L	probably benign	Het
Atxn2l	T	A	7: 126,495,866	K421N	probably damaging	Het
Cars2	T	C	8: 11,547,747	I110V	probably damaging	Het
Ccdc74a	A	G	16: 17,650,026	N249S	probably benign	Het
Cenpe	T	C	3: 135,222,321		probably benign	Het
Clptm1l	C	T	13: 73,607,723	Q153*	probably null	Het
Cnep1r1	G	T	8: 88,118,817		probably benign	Het
Cyp2d37-ps	C	T	15: 82,690,088		noncoding transcript	Het
Cyp3a25	A	G	5: 145,986,969		probably benign	Het
Dis3l	G	T	9: 64,339,573	Q67K	probably benign	Het
Dnah1	A	G	14: 31,271,129	V2936A	probably damaging	Het
Dnah5	C	T	15: 28,366,270	R2710C	probably damaging	Het
Dtx2	C	T	5: 136,030,577	S493F	probably damaging	Het
Dvl3	G	A	16: 20,526,351	S361N	probably benign	Het
Ehd1	T	C	19: 6,298,078	L362P	probably benign	Het
Eif2ak3	T	C	6: 70,904,197	V1085A	probably benign	Het
Eif3b	T	C	5: 140,426,453	Y226H	probably damaging	Het
Endov	T	C	11: 119,499,582	F12S	probably damaging	Het
Ercc1	A	G	7: 19,354,370	*37W	probably null	Het
Evi2a	G	A	11: 79,527,767	Q6*	probably null	Het
Faah	C	T	4: 115,998,573	V552M	probably damaging	Het
Fat1	T	A	8: 45,024,332	N2138K	probably damaging	Het
Fat1	T	A	8: 45,026,704	V2929E	probably damaging	Het
Gm2959	A	G	14: 42,413,701		noncoding transcript	Het
Gm6327	A	T	16: 12,761,115		noncoding transcript	Het
Gm9912	T	C	3: 149,185,159	T113A	unknown	Het
Gtf2f2	A	G	14: 75,917,696	S142P	possibly damaging	Het
Hspg2	A	T	4: 137,559,367	T3666S	possibly damaging	Het
Htt	C	T	5: 34,825,982	T975I	probably benign	Het
Il2rg	A	G	X: 101,267,810	L57P	possibly damaging	Het
Iqgap1	G	A	7: 80,723,979	Q1421*	probably null	Het
Itga3	T	A	11: 95,054,076	Q802L	possibly damaging	Het
Lonp2	A	G	8: 86,665,775	T490A	probably damaging	Het
Lztr1	T	C	16: 17,509,670	V79A	probably damaging	Het
Mast4	C	T	13: 102,759,093	E736K	probably benign	Het
Mpp4	G	A	1: 59,143,782	P322L	possibly damaging	Het
Mrto4	T	C	4: 139,349,023	K86E	probably benign	Het
Myof	A	G	19: 37,915,746	V2A	possibly damaging	Het
Naf1	A	G	8: 66,887,780	D414G	probably damaging	Het
Nav3	G	A	10: 109,720,021	T1683M	probably damaging	Het
Nbea	A	G	3: 56,086,157		probably benign	Het
Nebl	A	T	2: 17,397,121	M427K	probably benign	Het
Ngdn	T	C	14: 55,022,107	V205A	possibly damaging	Het
Nup133	C	A	8: 123,914,575	D869Y	probably damaging	Het
Oas1g	T	C	5: 120,885,883	E121G	probably damaging	Het
Olfr1034	A	G	2: 86,046,955	T158A	probably damaging	Het
Olfr1404	T	C	1: 173,215,710	F20L	probably benign	Het
Olfr322	G	T	11: 58,665,982	C141F	probably damaging	Het
Olfr324	A	G	11: 58,597,570	N58S	probably damaging	Het
Olfr775	T	A	10: 129,251,132	Y199*	probably null	Het
Park7	T	C	4: 150,905,275	N76S	probably benign	Het
Pcdh8	A	T	14: 79,768,211	S912R	probably damaging	Het
Pkhd1	A	G	1: 20,201,335	I2998T	probably damaging	Het
Plxnb3	T	A	X: 73,771,751	Y1845*	probably null	Het
Ppard	A	G	17: 28,299,689	H388R	probably damaging	Het
Psma1	A	G	7: 114,269,766	S142P	possibly damaging	Het
Rbl2	C	A	8: 91,106,739	P714Q	probably damaging	Het
Rexo2	A	T	9: 48,474,513	S104T	possibly damaging	Het
Sema5a	T	C	15: 32,609,217		probably benign	Het
Sun2	A	G	15: 79,738,651	L109P	probably damaging	Het
Tdg	A	G	10: 82,641,534	T116A	probably benign	Het
Terb1	A	T	8: 104,468,748	M587K	possibly damaging	Het
Tex43	C	T	18: 56,588,463	Q25*	probably null	Het
Tmcc1	C	T	6: 116,043,058	V118M	probably benign	Het
Tnfsf11	T	A	14: 78,278,922	N202I	probably damaging	Het
Togaram2	T	C	17: 71,716,365	S759P	probably benign	Het
Ttc7b	G	A	12: 100,325,689	A208V	probably damaging	Het
Tti2	T	C	8: 31,154,310		probably benign	Het
Wnk1	T	C	6: 119,928,157		probably null	Het
Zfyve26	T	C	12: 79,284,032		probably null	Het
Zfyve28	T	C	5: 34,234,337	M157V	probably null	Het
Zgrf1	T	C	3: 127,613,350	C1589R	probably damaging	Het

Other mutations in Pth2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01333:Pth2r	APN	1	65388725	missense	probably benign	0.08
IGL02054:Pth2r	APN	1	65336781	missense	probably damaging	1.00
IGL02429:Pth2r	APN	1	65346839	missense	probably benign	0.05
R0277:Pth2r	UTSW	1	65388616	missense	probably benign
R0323:Pth2r	UTSW	1	65388616	missense	probably benign
R0415:Pth2r	UTSW	1	65388439	missense	probably benign
R1067:Pth2r	UTSW	1	65372348	missense	possibly damaging	0.92
R1463:Pth2r	UTSW	1	65363277	missense	probably damaging	0.96
R1566:Pth2r	UTSW	1	65388538	missense	possibly damaging	0.50
R1690:Pth2r	UTSW	1	65372303	missense	probably benign	0.02
R1710:Pth2r	UTSW	1	65336838	missense	possibly damaging	0.48
R1957:Pth2r	UTSW	1	65372355	missense	probably damaging	1.00
R2232:Pth2r	UTSW	1	65336769	missense	probably damaging	1.00
R2942:Pth2r	UTSW	1	65388476	missense	probably benign	0.00
R3011:Pth2r	UTSW	1	65336988	missense	probably benign	0.05
R3857:Pth2r	UTSW	1	65322047	missense	probably damaging	0.98
R3858:Pth2r	UTSW	1	65322047	missense	probably damaging	0.98
R3859:Pth2r	UTSW	1	65322047	missense	probably damaging	0.98
R4540:Pth2r	UTSW	1	65282201	missense	probably benign
R4694:Pth2r	UTSW	1	65336761	missense	probably benign
R4777:Pth2r	UTSW	1	65388517	missense	possibly damaging	0.90
R4926:Pth2r	UTSW	1	65321984	missense	probably benign	0.27
R5209:Pth2r	UTSW	1	65388697	missense	probably benign	0.04
R5871:Pth2r	UTSW	1	65388637	missense	probably damaging	1.00
R6868:Pth2r	UTSW	1	65388479	missense	probably benign	0.02
R7132:Pth2r	UTSW	1	65322066	missense	probably benign	0.00
R7242:Pth2r	UTSW	1	65388620	missense	probably benign	0.42
R7677:Pth2r	UTSW	1	65388446	missense	probably benign	0.00
R7836:Pth2r	UTSW	1	65351563	missense	probably damaging	1.00
R8061:Pth2r	UTSW	1	65343501	missense	possibly damaging	0.64
Z1176:Pth2r	UTSW	1	65363308	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- ACAGCCCATTAAAGCTAGAGAG -3'
(R):5'- GCTTCACACACTTAATGCTTTCAG -3'

Sequencing Primer
(F):5'- GCCCATTAAAGCTAGAGAGAACCAG -3'
(R):5'- GGTTAGGATCAGATCACCATTAGCC -3'

Posted On

2014-09-17