Incidental Mutation 'R2062:A2ml1'
ID228757
Institutional Source Beutler Lab
Gene Symbol A2ml1
Ensembl Gene ENSMUSG00000047228
Gene Namealpha-2-macroglobulin like 1
Synonyms
MMRRC Submission 040067-MU
Accession Numbers

Genbank: NM_001001179.3; Ensembl: ENSMUST00000060574

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2062 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location128539821-128581608 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128552308 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 957 (M957K)
Ref Sequence ENSEMBL: ENSMUSP00000059426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060574]
Predicted Effect probably benign
Transcript: ENSMUST00000060574
AA Change: M957K

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228
AA Change: M957K

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
Pfam:A2M_N 120 213 6.3e-17 PFAM
A2M_N_2 448 594 2.95e-37 SMART
A2M 736 826 2.11e-33 SMART
Pfam:Thiol-ester_cl 959 988 3.1e-17 PFAM
Pfam:A2M_comp 1008 1255 2.3e-71 PFAM
A2M_recep 1361 1447 1.22e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205167
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (84/85)
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
Adam7 C A 14: 68,505,161 V668F probably benign Het
Adcy7 T G 8: 88,312,274 L306R probably damaging Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ano7 T C 1: 93,390,313 V249A probably benign Het
Aox1 T C 1: 58,059,192 probably null Het
Asah2 A T 19: 32,024,874 V290E probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Atxn2l T A 7: 126,495,866 K421N probably damaging Het
Cars2 T C 8: 11,547,747 I110V probably damaging Het
Ccdc74a A G 16: 17,650,026 N249S probably benign Het
Cenpe T C 3: 135,222,321 probably benign Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cyp2d37-ps C T 15: 82,690,088 noncoding transcript Het
Cyp3a25 A G 5: 145,986,969 probably benign Het
Dis3l G T 9: 64,339,573 Q67K probably benign Het
Dnah1 A G 14: 31,271,129 V2936A probably damaging Het
Dnah5 C T 15: 28,366,270 R2710C probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Dvl3 G A 16: 20,526,351 S361N probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Eif2ak3 T C 6: 70,904,197 V1085A probably benign Het
Eif3b T C 5: 140,426,453 Y226H probably damaging Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Ercc1 A G 7: 19,354,370 *37W probably null Het
Evi2a G A 11: 79,527,767 Q6* probably null Het
Faah C T 4: 115,998,573 V552M probably damaging Het
Fat1 T A 8: 45,024,332 N2138K probably damaging Het
Fat1 T A 8: 45,026,704 V2929E probably damaging Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm6327 A T 16: 12,761,115 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Hspg2 A T 4: 137,559,367 T3666S possibly damaging Het
Htt C T 5: 34,825,982 T975I probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Iqgap1 G A 7: 80,723,979 Q1421* probably null Het
Itga3 T A 11: 95,054,076 Q802L possibly damaging Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Lztr1 T C 16: 17,509,670 V79A probably damaging Het
Mast4 C T 13: 102,759,093 E736K probably benign Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Myof A G 19: 37,915,746 V2A possibly damaging Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nav3 G A 10: 109,720,021 T1683M probably damaging Het
Nbea A G 3: 56,086,157 probably benign Het
Nebl A T 2: 17,397,121 M427K probably benign Het
Ngdn T C 14: 55,022,107 V205A possibly damaging Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1034 A G 2: 86,046,955 T158A probably damaging Het
Olfr1404 T C 1: 173,215,710 F20L probably benign Het
Olfr322 G T 11: 58,665,982 C141F probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr775 T A 10: 129,251,132 Y199* probably null Het
Park7 T C 4: 150,905,275 N76S probably benign Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pkhd1 A G 1: 20,201,335 I2998T probably damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Ppard A G 17: 28,299,689 H388R probably damaging Het
Psma1 A G 7: 114,269,766 S142P possibly damaging Het
Pth2r T C 1: 65,343,562 I158T probably damaging Het
Rbl2 C A 8: 91,106,739 P714Q probably damaging Het
Rexo2 A T 9: 48,474,513 S104T possibly damaging Het
Sema5a T C 15: 32,609,217 probably benign Het
Sun2 A G 15: 79,738,651 L109P probably damaging Het
Tdg A G 10: 82,641,534 T116A probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tex43 C T 18: 56,588,463 Q25* probably null Het
Tmcc1 C T 6: 116,043,058 V118M probably benign Het
Tnfsf11 T A 14: 78,278,922 N202I probably damaging Het
Togaram2 T C 17: 71,716,365 S759P probably benign Het
Ttc7b G A 12: 100,325,689 A208V probably damaging Het
Tti2 T C 8: 31,154,310 probably benign Het
Wnk1 T C 6: 119,928,157 probably null Het
Zfyve26 T C 12: 79,284,032 probably null Het
Zfyve28 T C 5: 34,234,337 M157V probably null Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in A2ml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:A2ml1 APN 6 128578156 missense possibly damaging 0.78
IGL00596:A2ml1 APN 6 128570067 missense probably damaging 0.99
IGL00912:A2ml1 APN 6 128552307 missense probably benign 0.04
IGL01320:A2ml1 APN 6 128575588 missense probably benign 0.00
IGL01470:A2ml1 APN 6 128580412 missense probably damaging 0.96
IGL01576:A2ml1 APN 6 128554330 splice site probably benign
IGL01761:A2ml1 APN 6 128546337 missense possibly damaging 0.61
IGL01792:A2ml1 APN 6 128560679 missense probably benign 0.04
IGL01843:A2ml1 APN 6 128553338 splice site probably benign
IGL01946:A2ml1 APN 6 128570479 missense possibly damaging 0.81
IGL02016:A2ml1 APN 6 128558335 missense probably damaging 1.00
IGL02170:A2ml1 APN 6 128547210 missense possibly damaging 0.58
IGL02269:A2ml1 APN 6 128553338 splice site probably benign
IGL02589:A2ml1 APN 6 128581500 missense probably benign 0.00
IGL02959:A2ml1 APN 6 128567060 missense probably benign 0.04
IGL02970:A2ml1 APN 6 128569979 missense probably damaging 1.00
IGL03206:A2ml1 APN 6 128553276 missense possibly damaging 0.50
IGL03298:A2ml1 APN 6 128543960 missense probably benign 0.00
1mM(1):A2ml1 UTSW 6 128580960 missense probably benign 0.02
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0128:A2ml1 UTSW 6 128575639 splice site probably benign
R0299:A2ml1 UTSW 6 128553232 splice site probably benign
R0523:A2ml1 UTSW 6 128558326 missense possibly damaging 0.92
R0565:A2ml1 UTSW 6 128568743 nonsense probably null
R0599:A2ml1 UTSW 6 128552245 missense probably damaging 1.00
R0626:A2ml1 UTSW 6 128550773 missense probably damaging 0.99
R0732:A2ml1 UTSW 6 128546448 missense probably damaging 1.00
R0880:A2ml1 UTSW 6 128560646 missense possibly damaging 0.49
R1070:A2ml1 UTSW 6 128543300 missense probably damaging 1.00
R1166:A2ml1 UTSW 6 128570917 missense probably benign 0.00
R1278:A2ml1 UTSW 6 128558507 missense probably damaging 1.00
R1421:A2ml1 UTSW 6 128543960 missense probably benign 0.00
R1536:A2ml1 UTSW 6 128547233 nonsense probably null
R1786:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R1808:A2ml1 UTSW 6 128543299 missense probably damaging 1.00
R1813:A2ml1 UTSW 6 128566273 missense probably benign 0.34
R1863:A2ml1 UTSW 6 128550783 missense probably damaging 0.99
R2007:A2ml1 UTSW 6 128542892 missense probably benign 0.13
R2127:A2ml1 UTSW 6 128558437 missense probably damaging 1.00
R2130:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2131:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2201:A2ml1 UTSW 6 128547305 missense probably null 0.34
R2319:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2321:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2322:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2369:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2370:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2371:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2372:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2375:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2893:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2894:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3438:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3615:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3616:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3773:A2ml1 UTSW 6 128555083 missense probably benign 0.02
R3785:A2ml1 UTSW 6 128544924 critical splice donor site probably null
R3803:A2ml1 UTSW 6 128545070 missense probably benign 0.17
R3824:A2ml1 UTSW 6 128568763 missense probably damaging 0.99
R3878:A2ml1 UTSW 6 128554361 missense probably benign 0.05
R4176:A2ml1 UTSW 6 128545037 missense possibly damaging 0.68
R4229:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4230:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4348:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4351:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4352:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4353:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4427:A2ml1 UTSW 6 128545046 missense probably benign 0.00
R4971:A2ml1 UTSW 6 128547227 missense probably damaging 0.98
R5014:A2ml1 UTSW 6 128543933 missense probably benign 0.00
R5369:A2ml1 UTSW 6 128568833 missense probably damaging 0.97
R5532:A2ml1 UTSW 6 128553330 critical splice acceptor site probably null
R5860:A2ml1 UTSW 6 128541061 missense probably benign 0.15
R5872:A2ml1 UTSW 6 128561526 missense probably damaging 1.00
R5926:A2ml1 UTSW 6 128560645 missense probably benign
R5977:A2ml1 UTSW 6 128581122 missense probably damaging 1.00
R5980:A2ml1 UTSW 6 128567055 missense possibly damaging 0.82
R6014:A2ml1 UTSW 6 128571985 missense probably damaging 1.00
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6061:A2ml1 UTSW 6 128568712 missense probably damaging 1.00
R6327:A2ml1 UTSW 6 128558692 unclassified probably null
R6331:A2ml1 UTSW 6 128552236 missense probably damaging 0.96
R6465:A2ml1 UTSW 6 128541078 missense probably damaging 1.00
R6640:A2ml1 UTSW 6 128553285 missense probably benign 0.41
R6792:A2ml1 UTSW 6 128546329 nonsense probably null
R6793:A2ml1 UTSW 6 128546329 nonsense probably null
R7207:A2ml1 UTSW 6 128550771 missense probably benign 0.04
R7378:A2ml1 UTSW 6 128546247 critical splice donor site probably null
R7556:A2ml1 UTSW 6 128569964 missense probably damaging 1.00
R8010:A2ml1 UTSW 6 128580340 missense probably benign 0.08
R8017:A2ml1 UTSW 6 128581447 critical splice donor site probably null
R8019:A2ml1 UTSW 6 128581447 critical splice donor site probably null
R8035:A2ml1 UTSW 6 128553280 missense probably damaging 0.99
R8094:A2ml1 UTSW 6 128572082 missense probably damaging 1.00
R8144:A2ml1 UTSW 6 128569999 missense possibly damaging 0.84
RF014:A2ml1 UTSW 6 128570068 missense probably damaging 0.96
X0063:A2ml1 UTSW 6 128572012 missense probably benign
Z1176:A2ml1 UTSW 6 128571977 missense probably benign 0.09
Z1177:A2ml1 UTSW 6 128545076 missense probably benign
Z1177:A2ml1 UTSW 6 128561616 nonsense probably null
Z1177:A2ml1 UTSW 6 128575607 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCACCTTTGTGGGCGGAAAC -3'
(R):5'- AGAGCCACCTCCTTCTAGAG -3'

Sequencing Primer
(F):5'- ACGACTTAACCCTCTCACCATTGG -3'
(R):5'- TGTAGTGTTCACAAAGGCCC -3'
Posted On2014-09-17