Incidental Mutation 'R2062:Ercc1'
ID228758
Institutional Source Beutler Lab
Gene Symbol Ercc1
Ensembl Gene ENSMUSG00000003549
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 1
SynonymsErcc-1
MMRRC Submission 040067-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2062 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19344778-19356524 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 19354370 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 37 (*37W)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003645] [ENSMUST00000047036] [ENSMUST00000160369] [ENSMUST00000161378] [ENSMUST00000176818]
Predicted Effect probably damaging
Transcript: ENSMUST00000003645
AA Change: E216G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003645
Gene: ENSMUSG00000003549
AA Change: E216G

DomainStartEndE-ValueType
low complexity region 68 79 N/A INTRINSIC
Pfam:Rad10 100 213 2.9e-55 PFAM
HhH1 269 288 4.04e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047036
SMART Domains Protein: ENSMUSP00000044653
Gene: ENSMUSG00000047649

DomainStartEndE-ValueType
Pfam:RNA_polI_A34 37 397 7.5e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160192
Predicted Effect probably damaging
Transcript: ENSMUST00000160369
AA Change: E216G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125655
Gene: ENSMUSG00000003549
AA Change: E216G

DomainStartEndE-ValueType
low complexity region 68 79 N/A INTRINSIC
Pfam:Rad10 99 166 1.6e-34 PFAM
low complexity region 232 245 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160909
Predicted Effect probably benign
Transcript: ENSMUST00000161378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176723
Predicted Effect probably benign
Transcript: ENSMUST00000176818
SMART Domains Protein: ENSMUSP00000135767
Gene: ENSMUSG00000003549

DomainStartEndE-ValueType
Pfam:Rad10 23 90 8.4e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177486
AA Change: *37W
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene functions in the nucleotide excision repair pathway, and is required for the repair of DNA lesions such as those induced by UV light or formed by electrophilic compounds including cisplatin. The encoded protein forms a heterodimer with the XPF endonuclease (also known as ERCC4), and the heterodimeric endonuclease catalyzes the 5' incision in the process of excising the DNA lesion. The heterodimeric endonuclease is also involved in recombinational DNA repair and in the repair of inter-strand crosslinks. Mutations in this gene result in cerebrooculofacioskeletal syndrome, and polymorphisms that alter expression of this gene may play a role in carcinogenesis. Multiple transcript variants encoding different isoforms have been found for this gene. The last exon of this gene overlaps with the CD3e molecule, epsilon associated protein gene on the opposite strand. [provided by RefSeq, Oct 2009]
PHENOTYPE: Nullizygous mutations result in growth and liver failure, nuclear anomalies and postnatal death, and may lead to spleen hypoplasia, altered isotype switching, B cell hypoproliferation, dystonia, ataxia, renal failure, sarcopenia, kyphosis, early replicative aging and sensitivity to oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
A2ml1 A T 6: 128,552,308 M957K probably benign Het
Adam7 C A 14: 68,505,161 V668F probably benign Het
Adcy7 T G 8: 88,312,274 L306R probably damaging Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ano7 T C 1: 93,390,313 V249A probably benign Het
Aox1 T C 1: 58,059,192 probably null Het
Asah2 A T 19: 32,024,874 V290E probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Atxn2l T A 7: 126,495,866 K421N probably damaging Het
Cars2 T C 8: 11,547,747 I110V probably damaging Het
Ccdc74a A G 16: 17,650,026 N249S probably benign Het
Cenpe T C 3: 135,222,321 probably benign Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cyp2d37-ps C T 15: 82,690,088 noncoding transcript Het
Cyp3a25 A G 5: 145,986,969 probably benign Het
Dis3l G T 9: 64,339,573 Q67K probably benign Het
Dnah1 A G 14: 31,271,129 V2936A probably damaging Het
Dnah5 C T 15: 28,366,270 R2710C probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Dvl3 G A 16: 20,526,351 S361N probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Eif2ak3 T C 6: 70,904,197 V1085A probably benign Het
Eif3b T C 5: 140,426,453 Y226H probably damaging Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Evi2a G A 11: 79,527,767 Q6* probably null Het
Faah C T 4: 115,998,573 V552M probably damaging Het
Fat1 T A 8: 45,024,332 N2138K probably damaging Het
Fat1 T A 8: 45,026,704 V2929E probably damaging Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm6327 A T 16: 12,761,115 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Hspg2 A T 4: 137,559,367 T3666S possibly damaging Het
Htt C T 5: 34,825,982 T975I probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Iqgap1 G A 7: 80,723,979 Q1421* probably null Het
Itga3 T A 11: 95,054,076 Q802L possibly damaging Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Lztr1 T C 16: 17,509,670 V79A probably damaging Het
Mast4 C T 13: 102,759,093 E736K probably benign Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Myof A G 19: 37,915,746 V2A possibly damaging Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nav3 G A 10: 109,720,021 T1683M probably damaging Het
Nbea A G 3: 56,086,157 probably benign Het
Nebl A T 2: 17,397,121 M427K probably benign Het
Ngdn T C 14: 55,022,107 V205A possibly damaging Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1034 A G 2: 86,046,955 T158A probably damaging Het
Olfr1404 T C 1: 173,215,710 F20L probably benign Het
Olfr322 G T 11: 58,665,982 C141F probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr775 T A 10: 129,251,132 Y199* probably null Het
Park7 T C 4: 150,905,275 N76S probably benign Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pkhd1 A G 1: 20,201,335 I2998T probably damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Ppard A G 17: 28,299,689 H388R probably damaging Het
Psma1 A G 7: 114,269,766 S142P possibly damaging Het
Pth2r T C 1: 65,343,562 I158T probably damaging Het
Rbl2 C A 8: 91,106,739 P714Q probably damaging Het
Rexo2 A T 9: 48,474,513 S104T possibly damaging Het
Sema5a T C 15: 32,609,217 probably benign Het
Sun2 A G 15: 79,738,651 L109P probably damaging Het
Tdg A G 10: 82,641,534 T116A probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tex43 C T 18: 56,588,463 Q25* probably null Het
Tmcc1 C T 6: 116,043,058 V118M probably benign Het
Tnfsf11 T A 14: 78,278,922 N202I probably damaging Het
Togaram2 T C 17: 71,716,365 S759P probably benign Het
Ttc7b G A 12: 100,325,689 A208V probably damaging Het
Tti2 T C 8: 31,154,310 probably benign Het
Wnk1 T C 6: 119,928,157 probably null Het
Zfyve26 T C 12: 79,284,032 probably null Het
Zfyve28 T C 5: 34,234,337 M157V probably null Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Ercc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02929:Ercc1 APN 7 19355363 critical splice donor site probably null
joyless UTSW 7 19355177 splice site probably null
R4373:Ercc1 UTSW 7 19347132 unclassified probably benign
R4374:Ercc1 UTSW 7 19347132 unclassified probably benign
R4375:Ercc1 UTSW 7 19347132 unclassified probably benign
R4852:Ercc1 UTSW 7 19350704 missense probably damaging 1.00
R6000:Ercc1 UTSW 7 19347161 unclassified probably benign
R6415:Ercc1 UTSW 7 19355177 splice site probably null
X0057:Ercc1 UTSW 7 19356449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTGTGGTGGTAGAAGGAAC -3'
(R):5'- ACCCTTAATGCTGTTGGGAG -3'

Sequencing Primer
(F):5'- AGTGGTAGAGTCCCTGCCTAGAATC -3'
(R):5'- AATGCTGTTGGGAGGGGATGAG -3'
Posted On2014-09-17