Mutagenetix > Incidental Mutations

Incidental Mutation 'R2062:Ercc1'

228758

Institutional Source

Beutler Lab

Gene Symbol

Ercc1

Ensembl Gene

ENSMUSG00000003549

Gene Name

excision repair cross-complementing rodent repair deficiency, complementation group 1

Synonyms

Ercc-1

MMRRC Submission

040067-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2062 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19344778-19356524 bp(+) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

A to G at 19354370 bp

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Tryptophan at position 37 (*37W)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003645] [ENSMUST00000047036] [ENSMUST00000160369] [ENSMUST00000161378] [ENSMUST00000176818]

Predicted Effect

probably damaging
Transcript: ENSMUST00000003645
AA Change: E216G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000003645
Gene: ENSMUSG00000003549
AA Change: E216G

Domain	Start	End	E-Value	Type
low complexity region	68	79	N/A	INTRINSIC
Pfam:Rad10	100	213	2.9e-55	PFAM
HhH1	269	288	4.04e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000047036

SMART Domains

Protein: ENSMUSP00000044653
Gene: ENSMUSG00000047649

Domain	Start	End	E-Value	Type
Pfam:RNA_polI_A34	37	397	7.5e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160192

Predicted Effect

probably damaging
Transcript: ENSMUST00000160369
AA Change: E216G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125655
Gene: ENSMUSG00000003549
AA Change: E216G

Domain	Start	End	E-Value	Type
low complexity region	68	79	N/A	INTRINSIC
Pfam:Rad10	99	166	1.6e-34	PFAM
low complexity region	232	245	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160909

Predicted Effect

probably benign
Transcript: ENSMUST00000161378

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162197

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162992

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176333

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176723

Predicted Effect

probably benign
Transcript: ENSMUST00000176818

SMART Domains

Protein: ENSMUSP00000135767
Gene: ENSMUSG00000003549

Domain	Start	End	E-Value	Type
Pfam:Rad10	23	90	8.4e-35	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000177486
AA Change: *37W

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene functions in the nucleotide excision repair pathway, and is required for the repair of DNA lesions such as those induced by UV light or formed by electrophilic compounds including cisplatin. The encoded protein forms a heterodimer with the XPF endonuclease (also known as ERCC4), and the heterodimeric endonuclease catalyzes the 5' incision in the process of excising the DNA lesion. The heterodimeric endonuclease is also involved in recombinational DNA repair and in the repair of inter-strand crosslinks. Mutations in this gene result in cerebrooculofacioskeletal syndrome, and polymorphisms that alter expression of this gene may play a role in carcinogenesis. Multiple transcript variants encoding different isoforms have been found for this gene. The last exon of this gene overlaps with the CD3e molecule, epsilon associated protein gene on the opposite strand. [provided by RefSeq, Oct 2009]
PHENOTYPE: Nullizygous mutations result in growth and liver failure, nuclear anomalies and postnatal death, and may lead to spleen hypoplasia, altered isotype switching, B cell hypoproliferation, dystonia, ataxia, renal failure, sarcopenia, kyphosis, early replicative aging and sensitivity to oxidative stress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933436I01Rik	T	A	X: 67,920,702	I184L	probably benign	Het
A2ml1	A	T	6: 128,552,308	M957K	probably benign	Het
Adam7	C	A	14: 68,505,161	V668F	probably benign	Het
Adcy7	T	G	8: 88,312,274	L306R	probably damaging	Het
Akt3	A	G	1: 177,102,985	S136P	possibly damaging	Het
Alox12e	G	A	11: 70,316,002	R620W	probably damaging	Het
Amy2a1	T	C	3: 113,530,568	I108V	probably benign	Het
Ano7	T	C	1: 93,390,313	V249A	probably benign	Het
Aox1	T	C	1: 58,059,192		probably null	Het
Asah2	A	T	19: 32,024,874	V290E	probably damaging	Het
Ascc2	A	T	11: 4,681,496	M646L	probably benign	Het
Atxn2l	T	A	7: 126,495,866	K421N	probably damaging	Het
Cars2	T	C	8: 11,547,747	I110V	probably damaging	Het
Ccdc74a	A	G	16: 17,650,026	N249S	probably benign	Het
Cenpe	T	C	3: 135,222,321		probably benign	Het
Clptm1l	C	T	13: 73,607,723	Q153*	probably null	Het
Cnep1r1	G	T	8: 88,118,817		probably benign	Het
Cyp2d37-ps	C	T	15: 82,690,088		noncoding transcript	Het
Cyp3a25	A	G	5: 145,986,969		probably benign	Het
Dis3l	G	T	9: 64,339,573	Q67K	probably benign	Het
Dnah1	A	G	14: 31,271,129	V2936A	probably damaging	Het
Dnah5	C	T	15: 28,366,270	R2710C	probably damaging	Het
Dtx2	C	T	5: 136,030,577	S493F	probably damaging	Het
Dvl3	G	A	16: 20,526,351	S361N	probably benign	Het
Ehd1	T	C	19: 6,298,078	L362P	probably benign	Het
Eif2ak3	T	C	6: 70,904,197	V1085A	probably benign	Het
Eif3b	T	C	5: 140,426,453	Y226H	probably damaging	Het
Endov	T	C	11: 119,499,582	F12S	probably damaging	Het
Evi2a	G	A	11: 79,527,767	Q6*	probably null	Het
Faah	C	T	4: 115,998,573	V552M	probably damaging	Het
Fat1	T	A	8: 45,024,332	N2138K	probably damaging	Het
Fat1	T	A	8: 45,026,704	V2929E	probably damaging	Het
Gm2959	A	G	14: 42,413,701		noncoding transcript	Het
Gm6327	A	T	16: 12,761,115		noncoding transcript	Het
Gm9912	T	C	3: 149,185,159	T113A	unknown	Het
Gtf2f2	A	G	14: 75,917,696	S142P	possibly damaging	Het
Hspg2	A	T	4: 137,559,367	T3666S	possibly damaging	Het
Htt	C	T	5: 34,825,982	T975I	probably benign	Het
Il2rg	A	G	X: 101,267,810	L57P	possibly damaging	Het
Iqgap1	G	A	7: 80,723,979	Q1421*	probably null	Het
Itga3	T	A	11: 95,054,076	Q802L	possibly damaging	Het
Lonp2	A	G	8: 86,665,775	T490A	probably damaging	Het
Lztr1	T	C	16: 17,509,670	V79A	probably damaging	Het
Mast4	C	T	13: 102,759,093	E736K	probably benign	Het
Mpp4	G	A	1: 59,143,782	P322L	possibly damaging	Het
Mrto4	T	C	4: 139,349,023	K86E	probably benign	Het
Myof	A	G	19: 37,915,746	V2A	possibly damaging	Het
Naf1	A	G	8: 66,887,780	D414G	probably damaging	Het
Nav3	G	A	10: 109,720,021	T1683M	probably damaging	Het
Nbea	A	G	3: 56,086,157		probably benign	Het
Nebl	A	T	2: 17,397,121	M427K	probably benign	Het
Ngdn	T	C	14: 55,022,107	V205A	possibly damaging	Het
Nup133	C	A	8: 123,914,575	D869Y	probably damaging	Het
Oas1g	T	C	5: 120,885,883	E121G	probably damaging	Het
Olfr1034	A	G	2: 86,046,955	T158A	probably damaging	Het
Olfr1404	T	C	1: 173,215,710	F20L	probably benign	Het
Olfr322	G	T	11: 58,665,982	C141F	probably damaging	Het
Olfr324	A	G	11: 58,597,570	N58S	probably damaging	Het
Olfr775	T	A	10: 129,251,132	Y199*	probably null	Het
Park7	T	C	4: 150,905,275	N76S	probably benign	Het
Pcdh8	A	T	14: 79,768,211	S912R	probably damaging	Het
Pkhd1	A	G	1: 20,201,335	I2998T	probably damaging	Het
Plxnb3	T	A	X: 73,771,751	Y1845*	probably null	Het
Ppard	A	G	17: 28,299,689	H388R	probably damaging	Het
Psma1	A	G	7: 114,269,766	S142P	possibly damaging	Het
Pth2r	T	C	1: 65,343,562	I158T	probably damaging	Het
Rbl2	C	A	8: 91,106,739	P714Q	probably damaging	Het
Rexo2	A	T	9: 48,474,513	S104T	possibly damaging	Het
Sema5a	T	C	15: 32,609,217		probably benign	Het
Sun2	A	G	15: 79,738,651	L109P	probably damaging	Het
Tdg	A	G	10: 82,641,534	T116A	probably benign	Het
Terb1	A	T	8: 104,468,748	M587K	possibly damaging	Het
Tex43	C	T	18: 56,588,463	Q25*	probably null	Het
Tmcc1	C	T	6: 116,043,058	V118M	probably benign	Het
Tnfsf11	T	A	14: 78,278,922	N202I	probably damaging	Het
Togaram2	T	C	17: 71,716,365	S759P	probably benign	Het
Ttc7b	G	A	12: 100,325,689	A208V	probably damaging	Het
Tti2	T	C	8: 31,154,310		probably benign	Het
Wnk1	T	C	6: 119,928,157		probably null	Het
Zfyve26	T	C	12: 79,284,032		probably null	Het
Zfyve28	T	C	5: 34,234,337	M157V	probably null	Het
Zgrf1	T	C	3: 127,613,350	C1589R	probably damaging	Het

Other mutations in Ercc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02929:Ercc1	APN	7	19355363	critical splice donor site	probably null
joyless	UTSW	7	19355177	splice site	probably null
R4373:Ercc1	UTSW	7	19347132	unclassified	probably benign
R4374:Ercc1	UTSW	7	19347132	unclassified	probably benign
R4375:Ercc1	UTSW	7	19347132	unclassified	probably benign
R4852:Ercc1	UTSW	7	19350704	missense	probably damaging	1.00
R6000:Ercc1	UTSW	7	19347161	unclassified	probably benign
R6415:Ercc1	UTSW	7	19355177	splice site	probably null
X0057:Ercc1	UTSW	7	19356449	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTTGTGGTGGTAGAAGGAAC -3'
(R):5'- ACCCTTAATGCTGTTGGGAG -3'

Sequencing Primer
(F):5'- AGTGGTAGAGTCCCTGCCTAGAATC -3'
(R):5'- AATGCTGTTGGGAGGGGATGAG -3'

Posted On

2014-09-17