Mutagenetix > Incidental Mutations

Incidental Mutation 'R2062:Nup133'

228772

Institutional Source

Beutler Lab

Gene Symbol

Nup133

Ensembl Gene

ENSMUSG00000039509

Gene Name

nucleoporin 133

Synonyms

mermaid, 4832420O05Rik

MMRRC Submission

040067-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2062 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123897123-123949265 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 123914575 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 869 (D869Y)

Ref Sequence

ENSEMBL: ENSMUSP00000048084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044795
AA Change: D869Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: D869Y

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
PDB:1XKS\|A	66	513	N/A	PDB
Pfam:Nucleoporin_C	593	1052	1.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213089

Meta Mutation Damage Score

0.5513

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933436I01Rik	T	A	X: 67,920,702	I184L	probably benign	Het
A2ml1	A	T	6: 128,552,308	M957K	probably benign	Het
Adam7	C	A	14: 68,505,161	V668F	probably benign	Het
Adcy7	T	G	8: 88,312,274	L306R	probably damaging	Het
Akt3	A	G	1: 177,102,985	S136P	possibly damaging	Het
Alox12e	G	A	11: 70,316,002	R620W	probably damaging	Het
Amy2a1	T	C	3: 113,530,568	I108V	probably benign	Het
Ano7	T	C	1: 93,390,313	V249A	probably benign	Het
Aox1	T	C	1: 58,059,192		probably null	Het
Asah2	A	T	19: 32,024,874	V290E	probably damaging	Het
Ascc2	A	T	11: 4,681,496	M646L	probably benign	Het
Atxn2l	T	A	7: 126,495,866	K421N	probably damaging	Het
Cars2	T	C	8: 11,547,747	I110V	probably damaging	Het
Ccdc74a	A	G	16: 17,650,026	N249S	probably benign	Het
Cenpe	T	C	3: 135,222,321		probably benign	Het
Clptm1l	C	T	13: 73,607,723	Q153*	probably null	Het
Cnep1r1	G	T	8: 88,118,817		probably benign	Het
Cyp2d37-ps	C	T	15: 82,690,088		noncoding transcript	Het
Cyp3a25	A	G	5: 145,986,969		probably benign	Het
Dis3l	G	T	9: 64,339,573	Q67K	probably benign	Het
Dnah1	A	G	14: 31,271,129	V2936A	probably damaging	Het
Dnah5	C	T	15: 28,366,270	R2710C	probably damaging	Het
Dtx2	C	T	5: 136,030,577	S493F	probably damaging	Het
Dvl3	G	A	16: 20,526,351	S361N	probably benign	Het
Ehd1	T	C	19: 6,298,078	L362P	probably benign	Het
Eif2ak3	T	C	6: 70,904,197	V1085A	probably benign	Het
Eif3b	T	C	5: 140,426,453	Y226H	probably damaging	Het
Endov	T	C	11: 119,499,582	F12S	probably damaging	Het
Ercc1	A	G	7: 19,354,370	*37W	probably null	Het
Evi2a	G	A	11: 79,527,767	Q6*	probably null	Het
Faah	C	T	4: 115,998,573	V552M	probably damaging	Het
Fat1	T	A	8: 45,024,332	N2138K	probably damaging	Het
Fat1	T	A	8: 45,026,704	V2929E	probably damaging	Het
Gm2959	A	G	14: 42,413,701		noncoding transcript	Het
Gm6327	A	T	16: 12,761,115		noncoding transcript	Het
Gm9912	T	C	3: 149,185,159	T113A	unknown	Het
Gtf2f2	A	G	14: 75,917,696	S142P	possibly damaging	Het
Hspg2	A	T	4: 137,559,367	T3666S	possibly damaging	Het
Htt	C	T	5: 34,825,982	T975I	probably benign	Het
Il2rg	A	G	X: 101,267,810	L57P	possibly damaging	Het
Iqgap1	G	A	7: 80,723,979	Q1421*	probably null	Het
Itga3	T	A	11: 95,054,076	Q802L	possibly damaging	Het
Lonp2	A	G	8: 86,665,775	T490A	probably damaging	Het
Lztr1	T	C	16: 17,509,670	V79A	probably damaging	Het
Mast4	C	T	13: 102,759,093	E736K	probably benign	Het
Mpp4	G	A	1: 59,143,782	P322L	possibly damaging	Het
Mrto4	T	C	4: 139,349,023	K86E	probably benign	Het
Myof	A	G	19: 37,915,746	V2A	possibly damaging	Het
Naf1	A	G	8: 66,887,780	D414G	probably damaging	Het
Nav3	G	A	10: 109,720,021	T1683M	probably damaging	Het
Nbea	A	G	3: 56,086,157		probably benign	Het
Nebl	A	T	2: 17,397,121	M427K	probably benign	Het
Ngdn	T	C	14: 55,022,107	V205A	possibly damaging	Het
Oas1g	T	C	5: 120,885,883	E121G	probably damaging	Het
Olfr1034	A	G	2: 86,046,955	T158A	probably damaging	Het
Olfr1404	T	C	1: 173,215,710	F20L	probably benign	Het
Olfr322	G	T	11: 58,665,982	C141F	probably damaging	Het
Olfr324	A	G	11: 58,597,570	N58S	probably damaging	Het
Olfr775	T	A	10: 129,251,132	Y199*	probably null	Het
Park7	T	C	4: 150,905,275	N76S	probably benign	Het
Pcdh8	A	T	14: 79,768,211	S912R	probably damaging	Het
Pkhd1	A	G	1: 20,201,335	I2998T	probably damaging	Het
Plxnb3	T	A	X: 73,771,751	Y1845*	probably null	Het
Ppard	A	G	17: 28,299,689	H388R	probably damaging	Het
Psma1	A	G	7: 114,269,766	S142P	possibly damaging	Het
Pth2r	T	C	1: 65,343,562	I158T	probably damaging	Het
Rbl2	C	A	8: 91,106,739	P714Q	probably damaging	Het
Rexo2	A	T	9: 48,474,513	S104T	possibly damaging	Het
Sema5a	T	C	15: 32,609,217		probably benign	Het
Sun2	A	G	15: 79,738,651	L109P	probably damaging	Het
Tdg	A	G	10: 82,641,534	T116A	probably benign	Het
Terb1	A	T	8: 104,468,748	M587K	possibly damaging	Het
Tex43	C	T	18: 56,588,463	Q25*	probably null	Het
Tmcc1	C	T	6: 116,043,058	V118M	probably benign	Het
Tnfsf11	T	A	14: 78,278,922	N202I	probably damaging	Het
Togaram2	T	C	17: 71,716,365	S759P	probably benign	Het
Ttc7b	G	A	12: 100,325,689	A208V	probably damaging	Het
Tti2	T	C	8: 31,154,310		probably benign	Het
Wnk1	T	C	6: 119,928,157		probably null	Het
Zfyve26	T	C	12: 79,284,032		probably null	Het
Zfyve28	T	C	5: 34,234,337	M157V	probably null	Het
Zgrf1	T	C	3: 127,613,350	C1589R	probably damaging	Het

Other mutations in Nup133

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Nup133	APN	8	123939083	missense	probably damaging	0.98
IGL00507:Nup133	APN	8	123918967	nonsense	probably null
IGL00585:Nup133	APN	8	123909994	missense	probably damaging	1.00
IGL00676:Nup133	APN	8	123906298	intron	probably benign
IGL00966:Nup133	APN	8	123911906	missense	probably damaging	0.98
IGL01069:Nup133	APN	8	123930982	nonsense	probably null
IGL01553:Nup133	APN	8	123915324	missense	possibly damaging	0.58
IGL01669:Nup133	APN	8	123939130	nonsense	probably null
IGL01730:Nup133	APN	8	123938233	missense	probably benign	0.00
IGL01996:Nup133	APN	8	123946595	missense	probably benign	0.00
IGL02332:Nup133	APN	8	123907832	missense	probably damaging	1.00
IGL02552:Nup133	APN	8	123929255	missense	possibly damaging	0.75
IGL02956:Nup133	APN	8	123949083	missense	probably benign	0.00
IGL03009:Nup133	APN	8	123933500	missense	possibly damaging	0.46
IGL03036:Nup133	APN	8	123946594	missense	probably benign	0.11
Slant	UTSW	8	123916281	splice site	probably null
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0139:Nup133	UTSW	8	123929343	missense	probably benign	0.00
R0344:Nup133	UTSW	8	123917446	missense	possibly damaging	0.82
R0730:Nup133	UTSW	8	123949008	missense	probably benign	0.00
R1301:Nup133	UTSW	8	123917417	intron	probably benign
R1453:Nup133	UTSW	8	123915375	missense	probably benign	0.00
R1570:Nup133	UTSW	8	123949176	start codon destroyed	possibly damaging	0.82
R1607:Nup133	UTSW	8	123949035	missense	probably benign	0.02
R1773:Nup133	UTSW	8	123930983	nonsense	probably null
R1992:Nup133	UTSW	8	123906221	missense	possibly damaging	0.80
R2065:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2066:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2068:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R4397:Nup133	UTSW	8	123944301	missense	probably benign	0.04
R4683:Nup133	UTSW	8	123930982	nonsense	probably null
R4771:Nup133	UTSW	8	123929398	missense	probably damaging	1.00
R4910:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4911:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4968:Nup133	UTSW	8	123915196	missense	probably benign	0.07
R5411:Nup133	UTSW	8	123927206	missense	probably benign
R5470:Nup133	UTSW	8	123930966	missense	probably benign	0.00
R5664:Nup133	UTSW	8	123906281	missense	probably benign	0.01
R5907:Nup133	UTSW	8	123916299	missense	possibly damaging	0.90
R6003:Nup133	UTSW	8	123938292	missense	probably damaging	0.98
R6059:Nup133	UTSW	8	123914596	missense	probably damaging	1.00
R6219:Nup133	UTSW	8	123936873	missense	possibly damaging	0.90
R6292:Nup133	UTSW	8	123917437	missense	probably benign	0.01
R6672:Nup133	UTSW	8	123916281	splice site	probably null
R6737:Nup133	UTSW	8	123906291	missense	probably damaging	0.99
R6763:Nup133	UTSW	8	123944278	missense	possibly damaging	0.95
R6870:Nup133	UTSW	8	123899507	missense	probably benign	0.08
R6975:Nup133	UTSW	8	123915318	missense	probably damaging	0.99
R7101:Nup133	UTSW	8	123906227	missense	possibly damaging	0.89
R7114:Nup133	UTSW	8	123915373	missense	probably benign	0.00
R7271:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R7501:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R8054:Nup133	UTSW	8	123949217	intron	probably benign
R8397:Nup133	UTSW	8	123922417	missense	probably benign	0.17
R8703:Nup133	UTSW	8	123916282	critical splice donor site	probably null
R8811:Nup133	UTSW	8	123911888	frame shift	probably null
R8813:Nup133	UTSW	8	123911888	frame shift	probably null
X0023:Nup133	UTSW	8	123909988	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCCCAACAAGACAATGTAATGTG -3'
(R):5'- AGTGAGTAGTGGGAGTCTCCTC -3'

Sequencing Primer
(F):5'- ATGTGAAAATCTGTCATGTTCCCC -3'
(R):5'- TCTGGGGAGCCAGCAATG -3'

Posted On

2014-09-17