Incidental Mutation 'R0153:Adgre1'
ID22878
Institutional Source Beutler Lab
Gene Symbol Adgre1
Ensembl Gene ENSMUSG00000004730
Gene Nameadhesion G protein-coupled receptor E1
SynonymsEmr1, EGF-TM7, F4/80, DD7A5-7, TM7LN3, Ly71
MMRRC Submission 038436-MU
Accession Numbers

Ncbi RefSeq: NM_010130.4 ;MGI:106912

Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R0153 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location57358686-57483529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57443939 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 538 (S538T)
Ref Sequence ENSEMBL: ENSMUSP00000083971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004850
AA Change: S538T

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: S538T

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000086763
AA Change: S538T

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: S538T

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Meta Mutation Damage Score 0.1501 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency 97% (99/102)
MGI Phenotype Strain: 3582333
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik G T 9: 94,524,480 D291E probably benign Het
2010300C02Rik A G 1: 37,624,639 V726A probably benign Het
Abcb9 T C 5: 124,080,056 M406V probably benign Het
Adar T C 3: 89,730,814 S2P probably benign Het
Alms1 T A 6: 85,641,381 I2803N possibly damaging Het
Amn1 G T 6: 149,188,593 probably benign Het
Arid1b G A 17: 5,342,932 A2246T probably damaging Het
BC024139 T C 15: 76,121,747 E418G probably damaging Het
Bok A G 1: 93,686,517 D24G probably damaging Het
Cabp2 T C 19: 4,084,913 probably benign Het
Ccdc141 C A 2: 77,165,238 probably benign Het
Ccdc178 T C 18: 22,150,435 T13A probably benign Het
Ccdc42 G T 11: 68,587,650 V33F possibly damaging Het
Clcn7 G A 17: 25,149,202 probably benign Het
Cluh A G 11: 74,657,350 probably benign Het
Cr1l A T 1: 195,114,856 probably benign Het
Csnk1g3 T A 18: 53,918,789 probably benign Het
Depdc5 T C 5: 32,933,937 probably benign Het
Dgkh A C 14: 78,570,129 Y1149* probably null Het
Dnaic1 A G 4: 41,635,162 probably benign Het
Efcab2 A G 1: 178,474,886 E65G possibly damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam71e2 A T 7: 4,770,287 L177Q probably damaging Het
Fgfr4 A G 13: 55,161,385 probably benign Het
Gm10720 A C 9: 3,015,787 S44R probably null Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm6471 A T 7: 142,831,631 noncoding transcript Het
Gm8994 A T 6: 136,328,844 D101V probably damaging Het
Hnrnpm C T 17: 33,646,515 R724Q probably damaging Het
Homer1 C T 13: 93,391,746 T117I possibly damaging Het
Hoxd4 A T 2: 74,727,457 Q60L probably damaging Het
Ift172 T C 5: 31,260,624 R1274G probably benign Het
Ino80d A G 1: 63,058,318 S806P probably damaging Het
Itga10 T C 3: 96,653,700 V627A probably benign Het
Itgb2l A G 16: 96,437,369 Y77H possibly damaging Het
Kel A T 6: 41,701,943 H195Q probably benign Het
Klhdc7a A G 4: 139,967,271 S122P possibly damaging Het
Krt71 T A 15: 101,734,706 I456F possibly damaging Het
Lats1 T A 10: 7,691,575 S37T probably damaging Het
Lrp1b T A 2: 41,123,019 H1858L possibly damaging Het
Matk A T 10: 81,262,842 T461S probably benign Het
Meikin A G 11: 54,409,642 probably benign Het
Muc6 T C 7: 141,634,116 Q2832R possibly damaging Het
Myo10 T C 15: 25,781,238 F194L possibly damaging Het
Nbas G A 12: 13,273,876 probably benign Het
Nme4 A G 17: 26,093,857 probably null Het
Olfr1136 A G 2: 87,693,604 S93P probably benign Het
Olfr1217 T A 2: 89,023,196 N269I probably benign Het
Olfr1340 A T 4: 118,726,333 I29F possibly damaging Het
Olfr851 T A 9: 19,496,937 L63H probably damaging Het
Olfr954 T C 9: 39,461,671 V80A probably damaging Het
Pacsin2 T C 15: 83,377,661 Q473R probably benign Het
Patz1 A G 11: 3,293,288 H427R probably damaging Het
Pkp3 A G 7: 141,083,343 Y367C probably damaging Het
Prdm2 G A 4: 143,133,768 P984L possibly damaging Het
Rev3l T A 10: 39,874,128 C3091* probably null Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rpl5 T C 5: 107,904,757 F140L probably benign Het
Sec24a A C 11: 51,700,826 I1014M probably benign Het
Serpinb11 A G 1: 107,372,203 H93R probably benign Het
Shank2 C A 7: 144,070,135 H286N probably benign Het
Sipa1l2 G T 8: 125,421,898 Q1651K probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc30a5 A T 13: 100,826,494 F75L possibly damaging Het
Slco1a1 G T 6: 141,910,701 probably benign Het
Smg5 C T 3: 88,353,872 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Taf8 A T 17: 47,498,252 probably benign Het
Tarsl2 A G 7: 65,684,081 D617G probably damaging Het
Tbc1d5 A T 17: 50,984,687 probably benign Het
Tfcp2 C G 15: 100,514,827 E315Q probably damaging Het
Tmf1 A T 6: 97,170,384 S540R probably damaging Het
Tmprss4 T C 9: 45,184,336 Q70R probably benign Het
Trip13 G T 13: 73,920,064 A266E possibly damaging Het
Ttc24 T A 3: 88,074,927 probably benign Het
Ttll5 T A 12: 85,831,966 I49N probably damaging Het
Ube2ql1 A T 13: 69,738,592 M250K possibly damaging Het
Vmn1r87 A T 7: 13,132,284 D25E probably damaging Het
Vmn2r84 A G 10: 130,392,008 Y120H probably benign Het
Wdr6 G A 9: 108,575,242 R481C probably damaging Het
Wdr60 A G 12: 116,232,636 V497A probably benign Het
Zcchc6 G A 13: 59,782,336 R962* probably null Het
Zdhhc17 A T 10: 110,955,094 Y371* probably null Het
Zfp292 T C 4: 34,811,185 N620D probably benign Het
Zfp932 T A 5: 110,006,968 Y11N probably benign Het
Other mutations in Adgre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgre1 APN 17 57450055 missense probably benign 0.00
IGL00966:Adgre1 APN 17 57419335 missense probably benign 0.04
IGL01680:Adgre1 APN 17 57402620 missense unknown
IGL01724:Adgre1 APN 17 57444064 nonsense probably null
IGL02172:Adgre1 APN 17 57478879 missense probably damaging 1.00
IGL02260:Adgre1 APN 17 57447891 missense probably benign 0.01
IGL02272:Adgre1 APN 17 57450021 nonsense probably null
IGL02336:Adgre1 APN 17 57411024 nonsense probably null
IGL02346:Adgre1 APN 17 57443919 missense probably benign 0.15
IGL02398:Adgre1 APN 17 57402824 nonsense probably null
IGL02618:Adgre1 APN 17 57444021 missense possibly damaging 0.66
IGL02690:Adgre1 APN 17 57480921 missense probably damaging 1.00
IGL02936:Adgre1 APN 17 57478833 missense probably benign 0.26
IGL03112:Adgre1 APN 17 57448029 splice site probably null
IGL03350:Adgre1 APN 17 57401908 missense probably benign 0.16
F480 UTSW 17 57444063 missense probably damaging 1.00
lomax UTSW 17 57402811 missense unknown
Onion UTSW 17 57402841 nonsense probably null
Scallion UTSW 17 57401977 missense possibly damaging 0.90
R0049:Adgre1 UTSW 17 57402841 nonsense probably null
R0277:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0278:Adgre1 UTSW 17 57447872 missense probably benign 0.07
R0323:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0389:Adgre1 UTSW 17 57406839 missense possibly damaging 0.80
R0492:Adgre1 UTSW 17 57402742 missense unknown
R0621:Adgre1 UTSW 17 57441359 missense probably damaging 0.98
R0647:Adgre1 UTSW 17 57411003 missense probably damaging 1.00
R1310:Adgre1 UTSW 17 57447936 missense probably benign 0.00
R1601:Adgre1 UTSW 17 57441353 missense probably benign 0.01
R1689:Adgre1 UTSW 17 57449921 missense probably benign 0.31
R1708:Adgre1 UTSW 17 57401974 missense possibly damaging 0.93
R1796:Adgre1 UTSW 17 57441350 missense probably benign 0.43
R1839:Adgre1 UTSW 17 57441299 missense probably benign 0.00
R1860:Adgre1 UTSW 17 57441363 missense probably benign 0.00
R2165:Adgre1 UTSW 17 57419338 missense probably damaging 0.97
R2219:Adgre1 UTSW 17 57401912 missense possibly damaging 0.92
R2519:Adgre1 UTSW 17 57410956 missense probably damaging 1.00
R3874:Adgre1 UTSW 17 57401925 missense probably benign 0.08
R3911:Adgre1 UTSW 17 57447860 missense probably damaging 1.00
R4190:Adgre1 UTSW 17 57402811 missense unknown
R4439:Adgre1 UTSW 17 57447954 missense probably damaging 1.00
R4513:Adgre1 UTSW 17 57410947 missense probably benign 0.34
R4529:Adgre1 UTSW 17 57420519 missense possibly damaging 0.92
R4543:Adgre1 UTSW 17 57406874 missense probably benign 0.07
R4610:Adgre1 UTSW 17 57450073 missense possibly damaging 0.50
R4665:Adgre1 UTSW 17 57480947 missense probably benign 0.20
R4911:Adgre1 UTSW 17 57447832 missense possibly damaging 0.57
R4928:Adgre1 UTSW 17 57444064 nonsense probably null
R4942:Adgre1 UTSW 17 57406903 missense probably damaging 1.00
R4946:Adgre1 UTSW 17 57443918 missense probably benign 0.33
R4953:Adgre1 UTSW 17 57441321 missense probably damaging 0.99
R5107:Adgre1 UTSW 17 57401977 missense possibly damaging 0.90
R5366:Adgre1 UTSW 17 57402817 missense probably benign 0.39
R5590:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R5619:Adgre1 UTSW 17 57420437 missense probably benign 0.15
R5699:Adgre1 UTSW 17 57481007 missense probably benign 0.43
R5734:Adgre1 UTSW 17 57443990 missense probably benign 0.00
R5860:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6149:Adgre1 UTSW 17 57445018 missense probably benign 0.08
R6478:Adgre1 UTSW 17 57401955 missense possibly damaging 0.81
R6709:Adgre1 UTSW 17 57406917 missense probably benign 0.10
R6864:Adgre1 UTSW 17 57478879 missense probably damaging 1.00
R6945:Adgre1 UTSW 17 57410844 missense probably benign 0.01
R6945:Adgre1 UTSW 17 57420399 missense probably benign 0.39
R6988:Adgre1 UTSW 17 57408445 missense probably benign 0.00
R7019:Adgre1 UTSW 17 57410945 missense probably damaging 0.98
R7154:Adgre1 UTSW 17 57444087 splice site probably null
R7347:Adgre1 UTSW 17 57420441 missense probably damaging 1.00
R7459:Adgre1 UTSW 17 57449933 missense probably damaging 1.00
R7709:Adgre1 UTSW 17 57402519 missense unknown
Z1176:Adgre1 UTSW 17 57361729 missense not run
Z1177:Adgre1 UTSW 17 57419374 missense not run
Predicted Primers PCR Primer
(F):5'- ATGTTGCTCCACAGGCCATTGG -3'
(R):5'- AACCTGGATGTGCTGGAGGGTATAG -3'

Sequencing Primer
(F):5'- GCCTCAACTGATCTGAAAATTCTTGG -3'
(R):5'- TAGATAATAGGCTTGGAGAAGTCCTC -3'
Posted On2013-04-16