Incidental Mutation 'R2062:Adam7'
ID228794
Institutional Source Beutler Lab
Gene Symbol Adam7
Ensembl Gene ENSMUSG00000022056
Gene Namea disintegrin and metallopeptidase domain 7
SynonymsEAP1
MMRRC Submission 040067-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2062 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location68497336-68533741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 68505161 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 668 (V668F)
Ref Sequence ENSEMBL: ENSMUSP00000022640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022640]
Predicted Effect probably benign
Transcript: ENSMUST00000022640
AA Change: V668F

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022640
Gene: ENSMUSG00000022056
AA Change: V668F

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 25 156 1.6e-28 PFAM
Pfam:Reprolysin_5 197 378 1.2e-12 PFAM
Pfam:Reprolysin_4 197 382 2.6e-12 PFAM
Pfam:Reprolysin 199 393 1.3e-70 PFAM
Pfam:Reprolysin_2 219 383 1.1e-9 PFAM
Pfam:Reprolysin_3 223 346 9.5e-14 PFAM
DISIN 410 485 8.79e-30 SMART
ACR 486 623 3.51e-58 SMART
transmembrane domain 667 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128069
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is specifically expressed in epididymis where the encoded protein is transferred to the sperm surface during epididymal transit. This gene is located adjacent to a related gene from the ADAM family of proteins on chromosome 14. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility with decreased cell height in caput epididymis, spermatic granuloma, kinked sperm flagellum and reduced sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
A2ml1 A T 6: 128,552,308 M957K probably benign Het
Adcy7 T G 8: 88,312,274 L306R probably damaging Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ano7 T C 1: 93,390,313 V249A probably benign Het
Aox1 T C 1: 58,059,192 probably null Het
Asah2 A T 19: 32,024,874 V290E probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Atxn2l T A 7: 126,495,866 K421N probably damaging Het
Cars2 T C 8: 11,547,747 I110V probably damaging Het
Ccdc74a A G 16: 17,650,026 N249S probably benign Het
Cenpe T C 3: 135,222,321 probably benign Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cyp2d37-ps C T 15: 82,690,088 noncoding transcript Het
Cyp3a25 A G 5: 145,986,969 probably benign Het
Dis3l G T 9: 64,339,573 Q67K probably benign Het
Dnah1 A G 14: 31,271,129 V2936A probably damaging Het
Dnah5 C T 15: 28,366,270 R2710C probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Dvl3 G A 16: 20,526,351 S361N probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Eif2ak3 T C 6: 70,904,197 V1085A probably benign Het
Eif3b T C 5: 140,426,453 Y226H probably damaging Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Ercc1 A G 7: 19,354,370 *37W probably null Het
Evi2a G A 11: 79,527,767 Q6* probably null Het
Faah C T 4: 115,998,573 V552M probably damaging Het
Fat1 T A 8: 45,024,332 N2138K probably damaging Het
Fat1 T A 8: 45,026,704 V2929E probably damaging Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm6327 A T 16: 12,761,115 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Hspg2 A T 4: 137,559,367 T3666S possibly damaging Het
Htt C T 5: 34,825,982 T975I probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Iqgap1 G A 7: 80,723,979 Q1421* probably null Het
Itga3 T A 11: 95,054,076 Q802L possibly damaging Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Lztr1 T C 16: 17,509,670 V79A probably damaging Het
Mast4 C T 13: 102,759,093 E736K probably benign Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Myof A G 19: 37,915,746 V2A possibly damaging Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nav3 G A 10: 109,720,021 T1683M probably damaging Het
Nbea A G 3: 56,086,157 probably benign Het
Nebl A T 2: 17,397,121 M427K probably benign Het
Ngdn T C 14: 55,022,107 V205A possibly damaging Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1034 A G 2: 86,046,955 T158A probably damaging Het
Olfr1404 T C 1: 173,215,710 F20L probably benign Het
Olfr322 G T 11: 58,665,982 C141F probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr775 T A 10: 129,251,132 Y199* probably null Het
Park7 T C 4: 150,905,275 N76S probably benign Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pkhd1 A G 1: 20,201,335 I2998T probably damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Ppard A G 17: 28,299,689 H388R probably damaging Het
Psma1 A G 7: 114,269,766 S142P possibly damaging Het
Pth2r T C 1: 65,343,562 I158T probably damaging Het
Rbl2 C A 8: 91,106,739 P714Q probably damaging Het
Rexo2 A T 9: 48,474,513 S104T possibly damaging Het
Sema5a T C 15: 32,609,217 probably benign Het
Sun2 A G 15: 79,738,651 L109P probably damaging Het
Tdg A G 10: 82,641,534 T116A probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tex43 C T 18: 56,588,463 Q25* probably null Het
Tmcc1 C T 6: 116,043,058 V118M probably benign Het
Tnfsf11 T A 14: 78,278,922 N202I probably damaging Het
Togaram2 T C 17: 71,716,365 S759P probably benign Het
Ttc7b G A 12: 100,325,689 A208V probably damaging Het
Tti2 T C 8: 31,154,310 probably benign Het
Wnk1 T C 6: 119,928,157 probably null Het
Zfyve26 T C 12: 79,284,032 probably null Het
Zfyve28 T C 5: 34,234,337 M157V probably null Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Adam7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:Adam7 APN 14 68521938 missense possibly damaging 0.68
IGL01418:Adam7 APN 14 68525206 missense probably benign
IGL01934:Adam7 APN 14 68532599 missense probably damaging 1.00
IGL02655:Adam7 APN 14 68516611 missense probably damaging 1.00
IGL02669:Adam7 APN 14 68507894 missense probably damaging 1.00
PIT4445001:Adam7 UTSW 14 68509748 missense possibly damaging 0.88
R0195:Adam7 UTSW 14 68527627 splice site probably benign
R0277:Adam7 UTSW 14 68510857 splice site probably null
R0362:Adam7 UTSW 14 68509656 splice site probably benign
R0440:Adam7 UTSW 14 68510856 splice site probably null
R0927:Adam7 UTSW 14 68516684 missense probably damaging 1.00
R1172:Adam7 UTSW 14 68514921 missense probably damaging 1.00
R1270:Adam7 UTSW 14 68527669 missense probably damaging 0.98
R1299:Adam7 UTSW 14 68526299 splice site probably benign
R1527:Adam7 UTSW 14 68501521 missense probably benign 0.04
R1543:Adam7 UTSW 14 68521922 splice site probably benign
R1731:Adam7 UTSW 14 68525356 missense probably damaging 1.00
R1732:Adam7 UTSW 14 68498450 missense probably benign 0.00
R1921:Adam7 UTSW 14 68512625 missense possibly damaging 0.55
R2156:Adam7 UTSW 14 68511343 missense probably benign 0.02
R2353:Adam7 UTSW 14 68505088 missense probably benign 0.01
R2697:Adam7 UTSW 14 68514783 nonsense probably null
R4080:Adam7 UTSW 14 68520539 missense probably benign 0.05
R4775:Adam7 UTSW 14 68507912 missense probably benign 0.41
R5202:Adam7 UTSW 14 68507856 missense possibly damaging 0.92
R6006:Adam7 UTSW 14 68511396 missense probably damaging 1.00
R6087:Adam7 UTSW 14 68510757 missense probably damaging 1.00
R6376:Adam7 UTSW 14 68505097 missense possibly damaging 0.78
R6417:Adam7 UTSW 14 68504621 missense probably benign 0.37
R6672:Adam7 UTSW 14 68504702 critical splice acceptor site probably null
R6756:Adam7 UTSW 14 68525279 missense probably benign 0.00
R6777:Adam7 UTSW 14 68525335 missense probably damaging 1.00
R6913:Adam7 UTSW 14 68533651 missense probably benign 0.22
R7127:Adam7 UTSW 14 68514769 critical splice donor site probably null
R7209:Adam7 UTSW 14 68529819 missense probably damaging 1.00
R7399:Adam7 UTSW 14 68504466 splice site probably null
R7675:Adam7 UTSW 14 68499853 missense probably benign 0.07
R7788:Adam7 UTSW 14 68512645 missense possibly damaging 0.62
R7868:Adam7 UTSW 14 68532641 missense possibly damaging 0.84
R8135:Adam7 UTSW 14 68516573 missense probably damaging 1.00
R8281:Adam7 UTSW 14 68507885 missense possibly damaging 0.65
R8507:Adam7 UTSW 14 68526324 missense probably damaging 1.00
Z1176:Adam7 UTSW 14 68527701 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CCCTGCATTGACATTCTGTGG -3'
(R):5'- GTATCATGGAATCTTGAAGTTGGTTT -3'

Sequencing Primer
(F):5'- GGCAACAAGGTTAGTATGTACTTAG -3'
(R):5'- TACTGGGACATTGAGCCTTCACAG -3'
Posted On2014-09-17