Incidental Mutation 'R2062:Ehd1'
ID 228809
Institutional Source Beutler Lab
Gene Symbol Ehd1
Ensembl Gene ENSMUSG00000024772
Gene Name EH-domain containing 1
Synonyms RME-1, Past1
MMRRC Submission 040067-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2062 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 6276725-6300096 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6298078 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 362 (L362P)
Ref Sequence ENSEMBL: ENSMUSP00000025684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025684]
AlphaFold Q9WVK4
Predicted Effect probably benign
Transcript: ENSMUST00000025684
AA Change: L362P

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025684
Gene: ENSMUSG00000024772
AA Change: L362P

DomainStartEndE-ValueType
Pfam:EHD_N 24 56 1.2e-19 PFAM
Pfam:MMR_HSR1 60 220 5.1e-9 PFAM
Pfam:Dynamin_N 61 221 6.6e-15 PFAM
low complexity region 420 433 N/A INTRINSIC
EH 438 531 1.82e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171203
Meta Mutation Damage Score 0.1255 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a highly conserved gene family encoding EPS15 homology (EH) domain-containing proteins. The protein-binding EH domain was first noted in EPS15, a substrate for the epidermal growth factor receptor. The EH domain has been shown to be an important motif in proteins involved in protein-protein interactions and in intracellular sorting. The protein encoded by this gene is thought to play a role in the endocytosis of IGF1 receptors. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show perinatal and postnatal lethality, decreased body weight, and male infertility due to defective spermatogenesis; female homozygotes may display malocclusion and variable ocular defects, including congenital central cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
A2ml1 A T 6: 128,552,308 M957K probably benign Het
Adam7 C A 14: 68,505,161 V668F probably benign Het
Adcy7 T G 8: 88,312,274 L306R probably damaging Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ano7 T C 1: 93,390,313 V249A probably benign Het
Aox1 T C 1: 58,059,192 probably null Het
Asah2 A T 19: 32,024,874 V290E probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Atxn2l T A 7: 126,495,866 K421N probably damaging Het
Cars2 T C 8: 11,547,747 I110V probably damaging Het
Ccdc74a A G 16: 17,650,026 N249S probably benign Het
Cenpe T C 3: 135,222,321 probably benign Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cyp2d37-ps C T 15: 82,690,088 noncoding transcript Het
Cyp3a25 A G 5: 145,986,969 probably benign Het
Dis3l G T 9: 64,339,573 Q67K probably benign Het
Dnah1 A G 14: 31,271,129 V2936A probably damaging Het
Dnah5 C T 15: 28,366,270 R2710C probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Dvl3 G A 16: 20,526,351 S361N probably benign Het
Eif2ak3 T C 6: 70,904,197 V1085A probably benign Het
Eif3b T C 5: 140,426,453 Y226H probably damaging Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Ercc1 A G 7: 19,354,370 *37W probably null Het
Evi2a G A 11: 79,527,767 Q6* probably null Het
Faah C T 4: 115,998,573 V552M probably damaging Het
Fat1 T A 8: 45,024,332 N2138K probably damaging Het
Fat1 T A 8: 45,026,704 V2929E probably damaging Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm6327 A T 16: 12,761,115 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Hspg2 A T 4: 137,559,367 T3666S possibly damaging Het
Htt C T 5: 34,825,982 T975I probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Iqgap1 G A 7: 80,723,979 Q1421* probably null Het
Itga3 T A 11: 95,054,076 Q802L possibly damaging Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Lztr1 T C 16: 17,509,670 V79A probably damaging Het
Mast4 C T 13: 102,759,093 E736K probably benign Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Myof A G 19: 37,915,746 V2A possibly damaging Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nav3 G A 10: 109,720,021 T1683M probably damaging Het
Nbea A G 3: 56,086,157 probably benign Het
Nebl A T 2: 17,397,121 M427K probably benign Het
Ngdn T C 14: 55,022,107 V205A possibly damaging Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1034 A G 2: 86,046,955 T158A probably damaging Het
Olfr1404 T C 1: 173,215,710 F20L probably benign Het
Olfr322 G T 11: 58,665,982 C141F probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr775 T A 10: 129,251,132 Y199* probably null Het
Park7 T C 4: 150,905,275 N76S probably benign Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pkhd1 A G 1: 20,201,335 I2998T probably damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Ppard A G 17: 28,299,689 H388R probably damaging Het
Psma1 A G 7: 114,269,766 S142P possibly damaging Het
Pth2r T C 1: 65,343,562 I158T probably damaging Het
Rbl2 C A 8: 91,106,739 P714Q probably damaging Het
Rexo2 A T 9: 48,474,513 S104T possibly damaging Het
Sema5a T C 15: 32,609,217 probably benign Het
Sun2 A G 15: 79,738,651 L109P probably damaging Het
Tdg A G 10: 82,641,534 T116A probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tex43 C T 18: 56,588,463 Q25* probably null Het
Tmcc1 C T 6: 116,043,058 V118M probably benign Het
Tnfsf11 T A 14: 78,278,922 N202I probably damaging Het
Togaram2 T C 17: 71,716,365 S759P probably benign Het
Ttc7b G A 12: 100,325,689 A208V probably damaging Het
Tti2 T C 8: 31,154,310 probably benign Het
Wnk1 T C 6: 119,928,157 probably null Het
Zfyve26 T C 12: 79,284,032 probably null Het
Zfyve28 T C 5: 34,234,337 M157V probably null Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Ehd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ehd1 APN 19 6298147 missense possibly damaging 0.86
IGL02573:Ehd1 APN 19 6294300 missense probably damaging 1.00
IGL03146:Ehd1 APN 19 6277338 missense probably damaging 1.00
declining UTSW 19 6294388 missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6294388 missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6294388 missense probably damaging 1.00
R1593:Ehd1 UTSW 19 6298300 missense
R2064:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2065:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2066:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2067:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2068:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2217:Ehd1 UTSW 19 6298472 missense probably damaging 1.00
R3436:Ehd1 UTSW 19 6277014 nonsense probably null
R3705:Ehd1 UTSW 19 6298300 missense
R4654:Ehd1 UTSW 19 6276964 utr 5 prime probably benign
R4902:Ehd1 UTSW 19 6294243 missense possibly damaging 0.91
R5001:Ehd1 UTSW 19 6297694 missense probably benign 0.14
R5076:Ehd1 UTSW 19 6277221 missense probably benign 0.02
R6327:Ehd1 UTSW 19 6298345 missense possibly damaging 0.81
R6679:Ehd1 UTSW 19 6294444 missense probably benign 0.01
R7120:Ehd1 UTSW 19 6297561 missense probably benign 0.00
R7183:Ehd1 UTSW 19 6297654 missense probably benign 0.02
R7215:Ehd1 UTSW 19 6297642 missense possibly damaging 0.81
R7853:Ehd1 UTSW 19 6277195 missense probably damaging 0.99
R8467:Ehd1 UTSW 19 6281288 missense probably benign 0.24
R8523:Ehd1 UTSW 19 6294583 missense probably damaging 0.98
R8879:Ehd1 UTSW 19 6298324 missense probably damaging 0.97
R8957:Ehd1 UTSW 19 6294409 missense probably damaging 1.00
R9011:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R9664:Ehd1 UTSW 19 6281232 missense probably benign 0.01
R9687:Ehd1 UTSW 19 6298300 missense
Predicted Primers PCR Primer
(F):5'- CAGGGATAGTGCAGTTGTGACC -3'
(R):5'- ATCATCAATGCCCTCGCCAG -3'

Sequencing Primer
(F):5'- TAGCCTGAACTGGTAGGT -3'
(R):5'- CAAAGGGCCCATTCATGGTG -3'
Posted On 2014-09-17