Incidental Mutation 'R2062:Ehd1'
ID 228809
Institutional Source Beutler Lab
Gene Symbol Ehd1
Ensembl Gene ENSMUSG00000024772
Gene Name EH-domain containing 1
Synonyms RME-1, Past1
MMRRC Submission 040067-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2062 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 6326926-6350126 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6348108 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 362 (L362P)
Ref Sequence ENSEMBL: ENSMUSP00000025684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025684]
AlphaFold Q9WVK4
Predicted Effect probably benign
Transcript: ENSMUST00000025684
AA Change: L362P

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025684
Gene: ENSMUSG00000024772
AA Change: L362P

DomainStartEndE-ValueType
Pfam:EHD_N 24 56 1.2e-19 PFAM
Pfam:MMR_HSR1 60 220 5.1e-9 PFAM
Pfam:Dynamin_N 61 221 6.6e-15 PFAM
low complexity region 420 433 N/A INTRINSIC
EH 438 531 1.82e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171203
Meta Mutation Damage Score 0.1255 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a highly conserved gene family encoding EPS15 homology (EH) domain-containing proteins. The protein-binding EH domain was first noted in EPS15, a substrate for the epidermal growth factor receptor. The EH domain has been shown to be an important motif in proteins involved in protein-protein interactions and in intracellular sorting. The protein encoded by this gene is thought to play a role in the endocytosis of IGF1 receptors. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show perinatal and postnatal lethality, decreased body weight, and male infertility due to defective spermatogenesis; female homozygotes may display malocclusion and variable ocular defects, including congenital central cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 66,964,308 (GRCm39) I184L probably benign Het
A2ml1 A T 6: 128,529,271 (GRCm39) M957K probably benign Het
Adam7 C A 14: 68,742,610 (GRCm39) V668F probably benign Het
Adcy7 T G 8: 89,038,902 (GRCm39) L306R probably damaging Het
Akt3 A G 1: 176,930,551 (GRCm39) S136P possibly damaging Het
Alox12e G A 11: 70,206,828 (GRCm39) R620W probably damaging Het
Amy2a1 T C 3: 113,324,217 (GRCm39) I108V probably benign Het
Ano7 T C 1: 93,318,035 (GRCm39) V249A probably benign Het
Aox1 T C 1: 58,098,351 (GRCm39) probably null Het
Asah2 A T 19: 32,002,274 (GRCm39) V290E probably damaging Het
Ascc2 A T 11: 4,631,496 (GRCm39) M646L probably benign Het
Atxn2l T A 7: 126,095,038 (GRCm39) K421N probably damaging Het
Cars2 T C 8: 11,597,747 (GRCm39) I110V probably damaging Het
Ccdc74a A G 16: 17,467,890 (GRCm39) N249S probably benign Het
Cenpe T C 3: 134,928,082 (GRCm39) probably benign Het
Clptm1l C T 13: 73,755,842 (GRCm39) Q153* probably null Het
Cnep1r1 G T 8: 88,845,445 (GRCm39) probably benign Het
Cyp2d37-ps C T 15: 82,574,289 (GRCm39) noncoding transcript Het
Cyp3a25 A G 5: 145,923,779 (GRCm39) probably benign Het
Dis3l G T 9: 64,246,855 (GRCm39) Q67K probably benign Het
Dnah1 A G 14: 30,993,086 (GRCm39) V2936A probably damaging Het
Dnah5 C T 15: 28,366,416 (GRCm39) R2710C probably damaging Het
Dtx2 C T 5: 136,059,431 (GRCm39) S493F probably damaging Het
Dvl3 G A 16: 20,345,101 (GRCm39) S361N probably benign Het
Eif2ak3 T C 6: 70,881,181 (GRCm39) V1085A probably benign Het
Eif3b T C 5: 140,412,208 (GRCm39) Y226H probably damaging Het
Endov T C 11: 119,390,408 (GRCm39) F12S probably damaging Het
Ercc1 A G 7: 19,088,295 (GRCm39) *37W probably null Het
Evi2a G A 11: 79,418,593 (GRCm39) Q6* probably null Het
Faah C T 4: 115,855,770 (GRCm39) V552M probably damaging Het
Fat1 T A 8: 45,477,369 (GRCm39) N2138K probably damaging Het
Fat1 T A 8: 45,479,741 (GRCm39) V2929E probably damaging Het
Gm2959 A G 14: 42,235,658 (GRCm39) noncoding transcript Het
Gm6327 A T 16: 12,578,979 (GRCm39) noncoding transcript Het
Gm9912 T C 3: 148,890,795 (GRCm39) T113A unknown Het
Gtf2f2 A G 14: 76,155,136 (GRCm39) S142P possibly damaging Het
Hspg2 A T 4: 137,286,678 (GRCm39) T3666S possibly damaging Het
Htt C T 5: 34,983,326 (GRCm39) T975I probably benign Het
Il2rg A G X: 100,311,416 (GRCm39) L57P possibly damaging Het
Iqgap1 G A 7: 80,373,727 (GRCm39) Q1421* probably null Het
Itga3 T A 11: 94,944,902 (GRCm39) Q802L possibly damaging Het
Lonp2 A G 8: 87,392,403 (GRCm39) T490A probably damaging Het
Lztr1 T C 16: 17,327,534 (GRCm39) V79A probably damaging Het
Mast4 C T 13: 102,895,601 (GRCm39) E736K probably benign Het
Mpp4 G A 1: 59,182,941 (GRCm39) P322L possibly damaging Het
Mrto4 T C 4: 139,076,334 (GRCm39) K86E probably benign Het
Myof A G 19: 37,904,194 (GRCm39) V2A possibly damaging Het
Naf1 A G 8: 67,340,432 (GRCm39) D414G probably damaging Het
Nav3 G A 10: 109,555,882 (GRCm39) T1683M probably damaging Het
Nbea A G 3: 55,993,578 (GRCm39) probably benign Het
Nebl A T 2: 17,401,932 (GRCm39) M427K probably benign Het
Ngdn T C 14: 55,259,564 (GRCm39) V205A possibly damaging Het
Nup133 C A 8: 124,641,314 (GRCm39) D869Y probably damaging Het
Oas1g T C 5: 121,023,946 (GRCm39) E121G probably damaging Het
Or10j3b T C 1: 173,043,277 (GRCm39) F20L probably benign Het
Or2ab1 A G 11: 58,488,396 (GRCm39) N58S probably damaging Het
Or2w3 G T 11: 58,556,808 (GRCm39) C141F probably damaging Het
Or5m9 A G 2: 85,877,299 (GRCm39) T158A probably damaging Het
Or6c205 T A 10: 129,087,001 (GRCm39) Y199* probably null Het
Park7 T C 4: 150,989,732 (GRCm39) N76S probably benign Het
Pcdh8 A T 14: 80,005,651 (GRCm39) S912R probably damaging Het
Pkhd1 A G 1: 20,271,559 (GRCm39) I2998T probably damaging Het
Plxnb3 T A X: 72,815,357 (GRCm39) Y1845* probably null Het
Ppard A G 17: 28,518,663 (GRCm39) H388R probably damaging Het
Psma1 A G 7: 113,869,001 (GRCm39) S142P possibly damaging Het
Pth2r T C 1: 65,382,721 (GRCm39) I158T probably damaging Het
Rbl2 C A 8: 91,833,367 (GRCm39) P714Q probably damaging Het
Rexo2 A T 9: 48,385,813 (GRCm39) S104T possibly damaging Het
Sema5a T C 15: 32,609,363 (GRCm39) probably benign Het
Spmip10 C T 18: 56,721,535 (GRCm39) Q25* probably null Het
Sun2 A G 15: 79,622,852 (GRCm39) L109P probably damaging Het
Tdg A G 10: 82,477,368 (GRCm39) T116A probably benign Het
Terb1 A T 8: 105,195,380 (GRCm39) M587K possibly damaging Het
Tmcc1 C T 6: 116,020,019 (GRCm39) V118M probably benign Het
Tnfsf11 T A 14: 78,516,362 (GRCm39) N202I probably damaging Het
Togaram2 T C 17: 72,023,360 (GRCm39) S759P probably benign Het
Ttc7b G A 12: 100,291,948 (GRCm39) A208V probably damaging Het
Tti2 T C 8: 31,644,338 (GRCm39) probably benign Het
Wnk1 T C 6: 119,905,118 (GRCm39) probably null Het
Zfyve26 T C 12: 79,330,806 (GRCm39) probably null Het
Zfyve28 T C 5: 34,391,681 (GRCm39) M157V probably null Het
Zgrf1 T C 3: 127,406,999 (GRCm39) C1589R probably damaging Het
Other mutations in Ehd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ehd1 APN 19 6,348,177 (GRCm39) missense possibly damaging 0.86
IGL02573:Ehd1 APN 19 6,344,330 (GRCm39) missense probably damaging 1.00
IGL03146:Ehd1 APN 19 6,327,368 (GRCm39) missense probably damaging 1.00
declining UTSW 19 6,344,418 (GRCm39) missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6,344,418 (GRCm39) missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6,344,418 (GRCm39) missense probably damaging 1.00
R1593:Ehd1 UTSW 19 6,348,330 (GRCm39) missense
R2064:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2065:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2066:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2067:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2068:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2217:Ehd1 UTSW 19 6,348,502 (GRCm39) missense probably damaging 1.00
R3436:Ehd1 UTSW 19 6,327,044 (GRCm39) nonsense probably null
R3705:Ehd1 UTSW 19 6,348,330 (GRCm39) missense
R4654:Ehd1 UTSW 19 6,326,994 (GRCm39) utr 5 prime probably benign
R4902:Ehd1 UTSW 19 6,344,273 (GRCm39) missense possibly damaging 0.91
R5001:Ehd1 UTSW 19 6,347,724 (GRCm39) missense probably benign 0.14
R5076:Ehd1 UTSW 19 6,327,251 (GRCm39) missense probably benign 0.02
R6327:Ehd1 UTSW 19 6,348,375 (GRCm39) missense possibly damaging 0.81
R6679:Ehd1 UTSW 19 6,344,474 (GRCm39) missense probably benign 0.01
R7120:Ehd1 UTSW 19 6,347,591 (GRCm39) missense probably benign 0.00
R7183:Ehd1 UTSW 19 6,347,684 (GRCm39) missense probably benign 0.02
R7215:Ehd1 UTSW 19 6,347,672 (GRCm39) missense possibly damaging 0.81
R7853:Ehd1 UTSW 19 6,327,225 (GRCm39) missense probably damaging 0.99
R8467:Ehd1 UTSW 19 6,331,318 (GRCm39) missense probably benign 0.24
R8523:Ehd1 UTSW 19 6,344,613 (GRCm39) missense probably damaging 0.98
R8879:Ehd1 UTSW 19 6,348,354 (GRCm39) missense probably damaging 0.97
R8957:Ehd1 UTSW 19 6,344,439 (GRCm39) missense probably damaging 1.00
R9011:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R9664:Ehd1 UTSW 19 6,331,262 (GRCm39) missense probably benign 0.01
R9687:Ehd1 UTSW 19 6,348,330 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CAGGGATAGTGCAGTTGTGACC -3'
(R):5'- ATCATCAATGCCCTCGCCAG -3'

Sequencing Primer
(F):5'- TAGCCTGAACTGGTAGGT -3'
(R):5'- CAAAGGGCCCATTCATGGTG -3'
Posted On 2014-09-17