Incidental Mutation 'R0153:Cabp2'
ID22881
Institutional Source Beutler Lab
Gene Symbol Cabp2
Ensembl Gene ENSMUSG00000024857
Gene Namecalcium binding protein 2
Synonyms
MMRRC Submission 038436-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R0153 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4081578-4087340 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 4084913 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159148] [ENSMUST00000159556] [ENSMUST00000159593] [ENSMUST00000162908]
Predicted Effect probably benign
Transcript: ENSMUST00000159148
SMART Domains Protein: ENSMUSP00000125740
Gene: ENSMUSG00000024857

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
EFh 65 93 2.62e-5 SMART
Blast:EFh 101 126 3e-6 BLAST
EFh 139 167 1.26e-7 SMART
EFh 176 203 3.85e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159556
SMART Domains Protein: ENSMUSP00000124389
Gene: ENSMUSG00000024857

DomainStartEndE-ValueType
EFh 30 58 2.62e-5 SMART
Blast:EFh 66 91 2e-6 BLAST
EFh 104 132 1.26e-7 SMART
EFh 141 168 3.85e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159593
SMART Domains Protein: ENSMUSP00000124607
Gene: ENSMUSG00000024857

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
Pfam:EF-hand_1 65 93 2.8e-9 PFAM
Pfam:EF-hand_6 65 96 6.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162584
Predicted Effect probably benign
Transcript: ENSMUST00000162908
SMART Domains Protein: ENSMUSP00000125255
Gene: ENSMUSG00000024857

DomainStartEndE-ValueType
low complexity region 25 39 N/A INTRINSIC
EFh 83 111 2.62e-5 SMART
Blast:EFh 119 144 4e-6 BLAST
EFh 157 185 1.26e-7 SMART
EFh 194 221 3.85e-3 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a subfamily of calcium binding proteins that share similarity to calmodulin. Like calmodulin, these family members can likely stimulate calmodulin-dependent kinase II and the protein phosphatase calcineurin. Calcium binding proteins are an important component of calcium mediated cellular signal transduction. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous knockout affects calcium channels in cochlear inner hair cell synapses, resulting in hearing impairment. It also affects transmission of responses to light through the retinal circuits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik G T 9: 94,524,480 D291E probably benign Het
2010300C02Rik A G 1: 37,624,639 V726A probably benign Het
Abcb9 T C 5: 124,080,056 M406V probably benign Het
Adar T C 3: 89,730,814 S2P probably benign Het
Adgre1 T A 17: 57,443,939 S538T possibly damaging Het
Alms1 T A 6: 85,641,381 I2803N possibly damaging Het
Amn1 G T 6: 149,188,593 probably benign Het
Arid1b G A 17: 5,342,932 A2246T probably damaging Het
BC024139 T C 15: 76,121,747 E418G probably damaging Het
Bok A G 1: 93,686,517 D24G probably damaging Het
Ccdc141 C A 2: 77,165,238 probably benign Het
Ccdc178 T C 18: 22,150,435 T13A probably benign Het
Ccdc42 G T 11: 68,587,650 V33F possibly damaging Het
Clcn7 G A 17: 25,149,202 probably benign Het
Cluh A G 11: 74,657,350 probably benign Het
Cr1l A T 1: 195,114,856 probably benign Het
Csnk1g3 T A 18: 53,918,789 probably benign Het
Depdc5 T C 5: 32,933,937 probably benign Het
Dgkh A C 14: 78,570,129 Y1149* probably null Het
Dnaic1 A G 4: 41,635,162 probably benign Het
Efcab2 A G 1: 178,474,886 E65G possibly damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam71e2 A T 7: 4,770,287 L177Q probably damaging Het
Fgfr4 A G 13: 55,161,385 probably benign Het
Gm10720 A C 9: 3,015,787 S44R probably null Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm6471 A T 7: 142,831,631 noncoding transcript Het
Gm8994 A T 6: 136,328,844 D101V probably damaging Het
Hnrnpm C T 17: 33,646,515 R724Q probably damaging Het
Homer1 C T 13: 93,391,746 T117I possibly damaging Het
Hoxd4 A T 2: 74,727,457 Q60L probably damaging Het
Ift172 T C 5: 31,260,624 R1274G probably benign Het
Ino80d A G 1: 63,058,318 S806P probably damaging Het
Itga10 T C 3: 96,653,700 V627A probably benign Het
Itgb2l A G 16: 96,437,369 Y77H possibly damaging Het
Kel A T 6: 41,701,943 H195Q probably benign Het
Klhdc7a A G 4: 139,967,271 S122P possibly damaging Het
Krt71 T A 15: 101,734,706 I456F possibly damaging Het
Lats1 T A 10: 7,691,575 S37T probably damaging Het
Lrp1b T A 2: 41,123,019 H1858L possibly damaging Het
Matk A T 10: 81,262,842 T461S probably benign Het
Meikin A G 11: 54,409,642 probably benign Het
Muc6 T C 7: 141,634,116 Q2832R possibly damaging Het
Myo10 T C 15: 25,781,238 F194L possibly damaging Het
Nbas G A 12: 13,273,876 probably benign Het
Nme4 A G 17: 26,093,857 probably null Het
Olfr1136 A G 2: 87,693,604 S93P probably benign Het
Olfr1217 T A 2: 89,023,196 N269I probably benign Het
Olfr1340 A T 4: 118,726,333 I29F possibly damaging Het
Olfr851 T A 9: 19,496,937 L63H probably damaging Het
Olfr954 T C 9: 39,461,671 V80A probably damaging Het
Pacsin2 T C 15: 83,377,661 Q473R probably benign Het
Patz1 A G 11: 3,293,288 H427R probably damaging Het
Pkp3 A G 7: 141,083,343 Y367C probably damaging Het
Prdm2 G A 4: 143,133,768 P984L possibly damaging Het
Rev3l T A 10: 39,874,128 C3091* probably null Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rpl5 T C 5: 107,904,757 F140L probably benign Het
Sec24a A C 11: 51,700,826 I1014M probably benign Het
Serpinb11 A G 1: 107,372,203 H93R probably benign Het
Shank2 C A 7: 144,070,135 H286N probably benign Het
Sipa1l2 G T 8: 125,421,898 Q1651K probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc30a5 A T 13: 100,826,494 F75L possibly damaging Het
Slco1a1 G T 6: 141,910,701 probably benign Het
Smg5 C T 3: 88,353,872 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Taf8 A T 17: 47,498,252 probably benign Het
Tarsl2 A G 7: 65,684,081 D617G probably damaging Het
Tbc1d5 A T 17: 50,984,687 probably benign Het
Tfcp2 C G 15: 100,514,827 E315Q probably damaging Het
Tmf1 A T 6: 97,170,384 S540R probably damaging Het
Tmprss4 T C 9: 45,184,336 Q70R probably benign Het
Trip13 G T 13: 73,920,064 A266E possibly damaging Het
Ttc24 T A 3: 88,074,927 probably benign Het
Ttll5 T A 12: 85,831,966 I49N probably damaging Het
Ube2ql1 A T 13: 69,738,592 M250K possibly damaging Het
Vmn1r87 A T 7: 13,132,284 D25E probably damaging Het
Vmn2r84 A G 10: 130,392,008 Y120H probably benign Het
Wdr6 G A 9: 108,575,242 R481C probably damaging Het
Wdr60 A G 12: 116,232,636 V497A probably benign Het
Zcchc6 G A 13: 59,782,336 R962* probably null Het
Zdhhc17 A T 10: 110,955,094 Y371* probably null Het
Zfp292 T C 4: 34,811,185 N620D probably benign Het
Zfp932 T A 5: 110,006,968 Y11N probably benign Het
Other mutations in Cabp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Cabp2 APN 19 4084868 splice site probably benign
IGL02338:Cabp2 APN 19 4084154 missense possibly damaging 0.74
R0017:Cabp2 UTSW 19 4086242 missense possibly damaging 0.88
R0432:Cabp2 UTSW 19 4084903 missense possibly damaging 0.59
R2027:Cabp2 UTSW 19 4087126 missense probably damaging 1.00
R3693:Cabp2 UTSW 19 4083593 missense probably benign 0.02
R3694:Cabp2 UTSW 19 4083593 missense probably benign 0.02
R3695:Cabp2 UTSW 19 4083593 missense probably benign 0.02
R5935:Cabp2 UTSW 19 4086497 missense probably damaging 1.00
R5939:Cabp2 UTSW 19 4086470 missense possibly damaging 0.85
R6413:Cabp2 UTSW 19 4085698 splice site probably null
R7023:Cabp2 UTSW 19 4082658 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAGTCCAGTGGCAGAATACTTG -3'
(R):5'- AAAGCAGTCCTTGACCAGTGTGG -3'

Sequencing Primer
(F):5'- ttacatctccagcacagcc -3'
(R):5'- GTCACTGAGACCAAGGGGTTG -3'
Posted On2013-04-16