Incidental Mutation 'R2062:Myof'
ID228811
Institutional Source Beutler Lab
Gene Symbol Myof
Ensembl Gene ENSMUSG00000048612
Gene Namemyoferlin
SynonymsFer1l3, E030042N20Rik, 2310051D19Rik
MMRRC Submission 040067-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2062 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location37899036-38043577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37915746 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2 (V2A)
Ref Sequence ENSEMBL: ENSMUSP00000153534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000224560] [ENSMUST00000225159] [ENSMUST00000226068]
Predicted Effect probably benign
Transcript: ENSMUST00000041475
AA Change: V1651A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612
AA Change: V1651A

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1425 1436 N/A INTRINSIC
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
Pfam:Ferlin_C 1939 2043 2.4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172095
AA Change: V1651A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612
AA Change: V1651A

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
transmembrane domain 2013 2035 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224518
Predicted Effect possibly damaging
Transcript: ENSMUST00000224560
AA Change: V2A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224580
Predicted Effect possibly damaging
Transcript: ENSMUST00000225159
AA Change: V910A

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000226068
AA Change: V1664A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
A2ml1 A T 6: 128,552,308 M957K probably benign Het
Adam7 C A 14: 68,505,161 V668F probably benign Het
Adcy7 T G 8: 88,312,274 L306R probably damaging Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ano7 T C 1: 93,390,313 V249A probably benign Het
Aox1 T C 1: 58,059,192 probably null Het
Asah2 A T 19: 32,024,874 V290E probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Atxn2l T A 7: 126,495,866 K421N probably damaging Het
Cars2 T C 8: 11,547,747 I110V probably damaging Het
Ccdc74a A G 16: 17,650,026 N249S probably benign Het
Cenpe T C 3: 135,222,321 probably benign Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cyp2d37-ps C T 15: 82,690,088 noncoding transcript Het
Cyp3a25 A G 5: 145,986,969 probably benign Het
Dis3l G T 9: 64,339,573 Q67K probably benign Het
Dnah1 A G 14: 31,271,129 V2936A probably damaging Het
Dnah5 C T 15: 28,366,270 R2710C probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Dvl3 G A 16: 20,526,351 S361N probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Eif2ak3 T C 6: 70,904,197 V1085A probably benign Het
Eif3b T C 5: 140,426,453 Y226H probably damaging Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Ercc1 A G 7: 19,354,370 *37W probably null Het
Evi2a G A 11: 79,527,767 Q6* probably null Het
Faah C T 4: 115,998,573 V552M probably damaging Het
Fat1 T A 8: 45,024,332 N2138K probably damaging Het
Fat1 T A 8: 45,026,704 V2929E probably damaging Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm6327 A T 16: 12,761,115 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Hspg2 A T 4: 137,559,367 T3666S possibly damaging Het
Htt C T 5: 34,825,982 T975I probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Iqgap1 G A 7: 80,723,979 Q1421* probably null Het
Itga3 T A 11: 95,054,076 Q802L possibly damaging Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Lztr1 T C 16: 17,509,670 V79A probably damaging Het
Mast4 C T 13: 102,759,093 E736K probably benign Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nav3 G A 10: 109,720,021 T1683M probably damaging Het
Nbea A G 3: 56,086,157 probably benign Het
Nebl A T 2: 17,397,121 M427K probably benign Het
Ngdn T C 14: 55,022,107 V205A possibly damaging Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1034 A G 2: 86,046,955 T158A probably damaging Het
Olfr1404 T C 1: 173,215,710 F20L probably benign Het
Olfr322 G T 11: 58,665,982 C141F probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr775 T A 10: 129,251,132 Y199* probably null Het
Park7 T C 4: 150,905,275 N76S probably benign Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pkhd1 A G 1: 20,201,335 I2998T probably damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Ppard A G 17: 28,299,689 H388R probably damaging Het
Psma1 A G 7: 114,269,766 S142P possibly damaging Het
Pth2r T C 1: 65,343,562 I158T probably damaging Het
Rbl2 C A 8: 91,106,739 P714Q probably damaging Het
Rexo2 A T 9: 48,474,513 S104T possibly damaging Het
Sema5a T C 15: 32,609,217 probably benign Het
Sun2 A G 15: 79,738,651 L109P probably damaging Het
Tdg A G 10: 82,641,534 T116A probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tex43 C T 18: 56,588,463 Q25* probably null Het
Tmcc1 C T 6: 116,043,058 V118M probably benign Het
Tnfsf11 T A 14: 78,278,922 N202I probably damaging Het
Togaram2 T C 17: 71,716,365 S759P probably benign Het
Ttc7b G A 12: 100,325,689 A208V probably damaging Het
Tti2 T C 8: 31,154,310 probably benign Het
Wnk1 T C 6: 119,928,157 probably null Het
Zfyve26 T C 12: 79,284,032 probably null Het
Zfyve28 T C 5: 34,234,337 M157V probably null Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Myof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Myof APN 19 37960934 missense probably benign 0.16
IGL00764:Myof APN 19 37974923 missense probably benign 0.04
IGL00801:Myof APN 19 37986073 missense probably damaging 0.99
IGL01084:Myof APN 19 37936436 missense probably damaging 1.00
IGL01368:Myof APN 19 37936457 missense probably damaging 0.97
IGL01472:Myof APN 19 37923076 missense probably benign
IGL01785:Myof APN 19 37980423 nonsense probably null
IGL02205:Myof APN 19 37924635 missense probably damaging 1.00
IGL02268:Myof APN 19 37954429 missense possibly damaging 0.50
IGL02268:Myof APN 19 37974863 missense possibly damaging 0.90
IGL02339:Myof APN 19 37972213 missense possibly damaging 0.46
IGL02433:Myof APN 19 37972193 missense probably benign 0.05
IGL02481:Myof APN 19 37937913 nonsense probably null
IGL02536:Myof APN 19 37949655 missense probably damaging 0.97
IGL02682:Myof APN 19 37921481 missense probably benign 0.09
IGL02732:Myof APN 19 37977716 missense possibly damaging 0.50
IGL02887:Myof APN 19 37920779 critical splice acceptor site probably null
IGL03114:Myof APN 19 37903861 missense probably damaging 1.00
IGL03137:Myof APN 19 37974889 missense probably damaging 1.00
IGL03340:Myof APN 19 37911159 missense probably damaging 1.00
PIT4791001:Myof UTSW 19 37982958 critical splice donor site probably null
R0024:Myof UTSW 19 37915740 missense probably damaging 0.98
R0140:Myof UTSW 19 37951556 nonsense probably null
R0309:Myof UTSW 19 37981266 missense probably benign 0.12
R0330:Myof UTSW 19 37935878 missense probably damaging 1.00
R0345:Myof UTSW 19 38024345 missense probably damaging 1.00
R0349:Myof UTSW 19 37910969 missense probably damaging 0.99
R0463:Myof UTSW 19 37916504 missense probably damaging 1.00
R0507:Myof UTSW 19 37901277 missense possibly damaging 0.94
R0512:Myof UTSW 19 37954524 missense possibly damaging 0.54
R0608:Myof UTSW 19 37916504 missense probably damaging 1.00
R0723:Myof UTSW 19 37981260 missense probably damaging 1.00
R1081:Myof UTSW 19 37986088 missense probably damaging 0.99
R1196:Myof UTSW 19 37910960 missense probably damaging 1.00
R1243:Myof UTSW 19 37936092 missense probably damaging 1.00
R1371:Myof UTSW 19 37903668 splice site probably benign
R1381:Myof UTSW 19 37995485 missense probably damaging 1.00
R1419:Myof UTSW 19 37901911 missense probably damaging 1.00
R1527:Myof UTSW 19 37924619 missense probably damaging 1.00
R1672:Myof UTSW 19 37943479 missense probably damaging 1.00
R1864:Myof UTSW 19 37986705 missense probably benign
R1914:Myof UTSW 19 37977693 missense probably damaging 1.00
R1915:Myof UTSW 19 37977693 missense probably damaging 1.00
R1970:Myof UTSW 19 37945634 missense probably damaging 0.99
R2144:Myof UTSW 19 37981221 critical splice donor site probably null
R2243:Myof UTSW 19 37901319 missense probably damaging 1.00
R2339:Myof UTSW 19 37937927 missense probably damaging 1.00
R2484:Myof UTSW 19 37903843 missense probably benign 0.13
R2880:Myof UTSW 19 37923025 missense probably benign 0.04
R3418:Myof UTSW 19 37922978 missense probably damaging 0.97
R3967:Myof UTSW 19 37901263 missense probably damaging 1.00
R3967:Myof UTSW 19 38022610 missense possibly damaging 0.59
R3970:Myof UTSW 19 37901263 missense probably damaging 1.00
R3970:Myof UTSW 19 38022610 missense possibly damaging 0.59
R4238:Myof UTSW 19 37923008 nonsense probably null
R4405:Myof UTSW 19 37922978 missense probably damaging 0.97
R4406:Myof UTSW 19 37922978 missense probably damaging 0.97
R4407:Myof UTSW 19 37922978 missense probably damaging 0.97
R4408:Myof UTSW 19 37922978 missense probably damaging 0.97
R4561:Myof UTSW 19 37922990 missense probably benign
R4606:Myof UTSW 19 37967099 missense probably damaging 1.00
R4778:Myof UTSW 19 37949563 missense probably damaging 1.00
R4801:Myof UTSW 19 37945738 missense probably benign 0.24
R4802:Myof UTSW 19 37945738 missense probably benign 0.24
R4812:Myof UTSW 19 37916559 missense probably damaging 1.00
R4884:Myof UTSW 19 37942357 missense probably damaging 1.00
R4964:Myof UTSW 19 37935852 missense probably damaging 0.97
R4966:Myof UTSW 19 37935852 missense probably damaging 0.97
R5069:Myof UTSW 19 37905325 missense possibly damaging 0.65
R5181:Myof UTSW 19 37932623 missense possibly damaging 0.95
R5376:Myof UTSW 19 37916400 missense probably damaging 1.00
R5384:Myof UTSW 19 37952987 missense probably damaging 0.98
R5543:Myof UTSW 19 37981330 missense probably benign 0.00
R5626:Myof UTSW 19 37922990 missense probably benign
R5865:Myof UTSW 19 37910934 missense probably damaging 1.00
R5919:Myof UTSW 19 38024370 missense possibly damaging 0.95
R5924:Myof UTSW 19 37982973 missense probably damaging 0.97
R5997:Myof UTSW 19 37905299 missense possibly damaging 0.90
R5999:Myof UTSW 19 37939856 nonsense probably null
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6041:Myof UTSW 19 37924620 missense probably damaging 1.00
R6051:Myof UTSW 19 38024361 missense probably damaging 1.00
R6057:Myof UTSW 19 37926981 critical splice donor site probably null
R6089:Myof UTSW 19 37967060 missense probably benign 0.37
R6195:Myof UTSW 19 37913357 missense possibly damaging 0.89
R6478:Myof UTSW 19 37903831 missense probably damaging 1.00
R6545:Myof UTSW 19 37942297 missense possibly damaging 0.67
R6655:Myof UTSW 19 37934791 missense probably damaging 1.00
R6715:Myof UTSW 19 37968346 missense probably benign 0.04
R6737:Myof UTSW 19 37943514 missense probably benign 0.01
R6837:Myof UTSW 19 37922956 critical splice donor site probably null
R7096:Myof UTSW 19 37936200 missense probably damaging 1.00
R7308:Myof UTSW 19 37910911 missense probably damaging 0.98
R7328:Myof UTSW 19 37916399 missense probably damaging 1.00
R7485:Myof UTSW 19 37951491 nonsense probably null
R7554:Myof UTSW 19 37954510 missense probably benign 0.09
R7759:Myof UTSW 19 37939898 missense probably benign 0.00
R7779:Myof UTSW 19 37939390 missense probably damaging 1.00
X0024:Myof UTSW 19 37974597 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CAGGAAATCATCAAGGCGC -3'
(R):5'- ATGAGTTGCCTGAAGCCAAC -3'

Sequencing Primer
(F):5'- GGTTATTATATTGTGCTTACAACCCC -3'
(R):5'- GAGTTGCCTGAAGCCAACATAATATG -3'
Posted On2014-09-17