Incidental Mutation 'R2063:Nckap1'
ID228818
Institutional Source Beutler Lab
Gene Symbol Nckap1
Ensembl Gene ENSMUSG00000027002
Gene NameNCK-associated protein 1
Synonymsmh19, Hem-2, Nap1, Hem2, H19
MMRRC Submission 040068-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2063 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location80500512-80581380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80570150 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 69 (K69R)
Ref Sequence ENSEMBL: ENSMUSP00000107390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028386] [ENSMUST00000111760]
Predicted Effect probably benign
Transcript: ENSMUST00000028386
AA Change: K63R

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028386
Gene: ENSMUSG00000027002
AA Change: K63R

DomainStartEndE-ValueType
Pfam:Nckap1 8 1124 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111760
AA Change: K69R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107390
Gene: ENSMUSG00000027002
AA Change: K69R

DomainStartEndE-ValueType
Pfam:Nckap1 9 1128 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene exhibit growth arrest at midgestation, an open neural tube, cardia bifida, defective foregut development, defects in endoderm and mesoderm migration and sometimes duplication of the anteroposterior body axis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Abca15 A T 7: 120,360,904 T637S possibly damaging Het
Adgrv1 T C 13: 81,561,469 K1135R possibly damaging Het
Afap1l1 A T 18: 61,739,122 probably null Het
AI467606 A G 7: 127,092,837 S195G probably damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Cic T A 7: 25,273,451 V869E probably damaging Het
Cpsf2 A G 12: 101,983,463 D118G probably damaging Het
Csnk1g1 A G 9: 66,002,230 S210G probably damaging Het
Cyp2c40 T A 19: 39,786,780 M343L probably benign Het
Cyp4a12b A T 4: 115,433,503 D274V possibly damaging Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah3 C T 7: 119,951,909 M3062I probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Elavl2 A T 4: 91,253,450 S278R possibly damaging Het
Emilin2 T C 17: 71,274,955 S259G probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Faim2 G A 15: 99,514,433 T140I probably damaging Het
Fbxo21 T C 5: 117,976,966 S56P probably benign Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Foxj2 A T 6: 122,840,241 H509L probably benign Het
Fth1 T A 19: 9,984,212 L49Q probably damaging Het
Gbp11 C A 5: 105,328,584 E220* probably null Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm1527 C A 3: 28,926,647 T632N probably benign Het
Gm4787 A T 12: 81,378,920 S155T probably benign Het
Gm9573 T A 17: 35,621,405 probably benign Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Helb T C 10: 120,105,766 Y339C probably benign Het
Hs3st4 A G 7: 124,397,013 I301V probably benign Het
Hunk A G 16: 90,493,480 D382G probably damaging Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il10 T C 1: 131,020,033 L41P probably damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Krt90 T C 15: 101,558,359 E263G probably benign Het
Lama2 C T 10: 27,164,926 C1467Y probably damaging Het
Med24 A G 11: 98,715,646 L330P probably damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Mtcl1 T C 17: 66,346,355 R1065G probably damaging Het
Mtmr14 G A 6: 113,240,361 G38D probably damaging Het
Mtus1 T C 8: 41,082,708 E657G probably damaging Het
Myo5c A T 9: 75,281,868 Q1020L probably benign Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nlrp1b T C 11: 71,161,086 N1012D probably benign Het
Ntrk2 A C 13: 58,859,297 K238Q probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr667 T C 7: 104,916,775 N174D probably benign Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pfpl C T 19: 12,429,873 S496L probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pkhd1l1 A T 15: 44,550,752 H2805L possibly damaging Het
Pla2g4a T C 1: 149,840,676 N678S possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Polr1a T G 6: 71,936,285 probably null Het
Prl3d3 A C 13: 27,162,321 E180D probably benign Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Prpf3 A T 3: 95,844,239 D383E probably benign Het
Psmc4 A T 7: 28,048,897 L73H probably damaging Het
Rapgef3 C A 15: 97,766,961 G7V probably damaging Het
Rasl12 G A 9: 65,410,824 G157R probably damaging Het
Rnf38 A C 4: 44,149,098 V83G probably damaging Het
Rnls A C 19: 33,202,544 S51A probably benign Het
Siglecf A G 7: 43,352,380 T205A possibly damaging Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc12a5 C T 2: 164,997,147 R1072W probably damaging Het
Spata13 GTTAGGCT GT 14: 60,760,871 probably benign Het
Specc1 T G 11: 62,118,296 S293A probably benign Het
Speer2 T G 16: 69,860,497 Q86P probably benign Het
Tbc1d15 T C 10: 115,229,173 D169G probably benign Het
Tbx20 C A 9: 24,769,771 E142* probably null Het
Tcp1 T A 17: 12,920,812 L199H probably damaging Het
Tex26 A T 5: 149,439,739 R5W probably damaging Het
Tg C A 15: 66,828,553 A120E probably damaging Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tmem57 A T 4: 134,828,279 N294K possibly damaging Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ush1c T C 7: 46,229,481 Y74C probably damaging Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Vps54 C T 11: 21,277,955 T176I probably damaging Het
Wdr95 T C 5: 149,579,162 probably null Het
Zfp81 T C 17: 33,335,304 T179A probably benign Het
Other mutations in Nckap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nckap1 APN 2 80506202 missense possibly damaging 0.87
IGL00896:Nckap1 APN 2 80580953 missense possibly damaging 0.59
IGL01343:Nckap1 APN 2 80519842 missense possibly damaging 0.81
IGL01593:Nckap1 APN 2 80520570 missense probably benign 0.06
IGL01677:Nckap1 APN 2 80530297 missense probably benign 0.04
IGL01873:Nckap1 APN 2 80553385 missense possibly damaging 0.95
IGL01874:Nckap1 APN 2 80525636 missense probably damaging 1.00
IGL01947:Nckap1 APN 2 80508753 missense probably damaging 1.00
IGL02268:Nckap1 APN 2 80528618 missense probably benign 0.16
IGL02348:Nckap1 APN 2 80517982 missense probably damaging 1.00
IGL03349:Nckap1 APN 2 80525560 missense probably benign 0.07
PIT4151001:Nckap1 UTSW 2 80520370 critical splice donor site probably null
R0326:Nckap1 UTSW 2 80553370 missense probably benign 0.41
R0345:Nckap1 UTSW 2 80544977 splice site probably benign
R0520:Nckap1 UTSW 2 80541530 splice site probably benign
R0603:Nckap1 UTSW 2 80512729 missense probably benign 0.19
R0924:Nckap1 UTSW 2 80554249 missense probably benign 0.34
R0930:Nckap1 UTSW 2 80554249 missense probably benign 0.34
R0964:Nckap1 UTSW 2 80547899 critical splice donor site probably null
R1122:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1123:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1124:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1125:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1127:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1182:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1234:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1236:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1384:Nckap1 UTSW 2 80533670 missense possibly damaging 0.90
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1511:Nckap1 UTSW 2 80553415 missense probably damaging 0.99
R1677:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1686:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1687:Nckap1 UTSW 2 80520585 missense probably damaging 0.96
R1717:Nckap1 UTSW 2 80512670 splice site probably benign
R1789:Nckap1 UTSW 2 80520556 missense probably benign 0.44
R1822:Nckap1 UTSW 2 80517898 missense possibly damaging 0.58
R1840:Nckap1 UTSW 2 80502250 missense possibly damaging 0.88
R1926:Nckap1 UTSW 2 80506838 missense probably damaging 1.00
R1968:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1970:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R2027:Nckap1 UTSW 2 80535518 missense probably damaging 1.00
R2504:Nckap1 UTSW 2 80530218 missense probably benign 0.40
R3824:Nckap1 UTSW 2 80540560 missense possibly damaging 0.72
R4784:Nckap1 UTSW 2 80506934 missense probably benign 0.15
R4908:Nckap1 UTSW 2 80523374 critical splice donor site probably null
R5077:Nckap1 UTSW 2 80548933 missense probably damaging 0.99
R5311:Nckap1 UTSW 2 80540122 missense probably damaging 1.00
R5439:Nckap1 UTSW 2 80512690 missense possibly damaging 0.81
R6141:Nckap1 UTSW 2 80530207 missense probably damaging 1.00
R6209:Nckap1 UTSW 2 80525602 missense probably damaging 1.00
R6226:Nckap1 UTSW 2 80508781 missense possibly damaging 0.96
R6294:Nckap1 UTSW 2 80541514 missense probably benign 0.03
R6458:Nckap1 UTSW 2 80512549 intron probably null
R6937:Nckap1 UTSW 2 80508716 missense probably damaging 1.00
R6986:Nckap1 UTSW 2 80520567 missense probably benign 0.03
R7180:Nckap1 UTSW 2 80506892 missense probably benign 0.01
R7208:Nckap1 UTSW 2 80540198 missense probably benign 0.24
R7363:Nckap1 UTSW 2 80540168 missense probably damaging 1.00
R7448:Nckap1 UTSW 2 80524541 missense probably damaging 1.00
R7513:Nckap1 UTSW 2 80502291 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GGTGCGGTTTATCTATCCATTACC -3'
(R):5'- GTGACAACCCCTGCACTTTG -3'

Sequencing Primer
(F):5'- ACCTATTCATCCAAGAAAATAGTGC -3'
(R):5'- TTCATTTATCACCTGCTCACCAAAAC -3'
Posted On2014-09-17