Incidental Mutation 'R2063:Slc12a5'
ID228819
Institutional Source Beutler Lab
Gene Symbol Slc12a5
Ensembl Gene ENSMUSG00000017740
Gene Namesolute carrier family 12, member 5
SynonymsKCC2
MMRRC Submission 040068-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2063 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164960802-164999731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 164997147 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 1072 (R1072W)
Ref Sequence ENSEMBL: ENSMUSP00000143870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040381] [ENSMUST00000099092] [ENSMUST00000121377] [ENSMUST00000122070] [ENSMUST00000202223] [ENSMUST00000202479] [ENSMUST00000202623]
Predicted Effect probably benign
Transcript: ENSMUST00000040381
SMART Domains Protein: ENSMUSP00000046388
Gene: ENSMUSG00000039804

DomainStartEndE-ValueType
low complexity region 46 79 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
coiled coil region 163 190 N/A INTRINSIC
SCOP:d1kmma1 195 287 2e-9 SMART
PDB:1V95|A 197 314 3e-79 PDB
low complexity region 324 340 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 395 427 N/A INTRINSIC
low complexity region 440 460 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099092
AA Change: R1054W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096690
Gene: ENSMUSG00000017740
AA Change: R1054W

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 304 5.2e-22 PFAM
Pfam:AA_permease_2 364 632 1e-17 PFAM
Pfam:AA_permease 389 676 1.9e-42 PFAM
Pfam:SLC12 688 814 2.1e-19 PFAM
Pfam:SLC12 807 959 1.8e-20 PFAM
low complexity region 978 1002 N/A INTRINSIC
Pfam:SLC12 1009 1115 2.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121377
SMART Domains Protein: ENSMUSP00000113872
Gene: ENSMUSG00000039804

DomainStartEndE-ValueType
PDB:1V95|A 1 34 2e-15 PDB
low complexity region 44 60 N/A INTRINSIC
low complexity region 87 96 N/A INTRINSIC
low complexity region 115 147 N/A INTRINSIC
low complexity region 160 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122070
SMART Domains Protein: ENSMUSP00000113166
Gene: ENSMUSG00000039804

DomainStartEndE-ValueType
low complexity region 46 79 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
coiled coil region 163 190 N/A INTRINSIC
SCOP:d1kmma1 195 287 1e-8 SMART
PDB:1V95|A 197 314 2e-80 PDB
low complexity region 324 340 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137302
Predicted Effect probably damaging
Transcript: ENSMUST00000202223
AA Change: R1072W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143870
Gene: ENSMUSG00000017740
AA Change: R1072W

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
Pfam:AA_permease 125 327 1e-19 PFAM
Pfam:AA_permease_2 386 655 4.5e-15 PFAM
Pfam:AA_permease 412 699 3.7e-40 PFAM
Pfam:SLC12 711 837 7.2e-17 PFAM
Pfam:SLC12 830 982 6.2e-18 PFAM
low complexity region 1001 1025 N/A INTRINSIC
Pfam:SLC12 1030 1133 8.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202479
SMART Domains Protein: ENSMUSP00000144540
Gene: ENSMUSG00000017740

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 176 5.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202623
AA Change: R1077W

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144623
Gene: ENSMUSG00000017740
AA Change: R1077W

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
Pfam:AA_permease 125 327 5.3e-22 PFAM
Pfam:AA_permease_2 386 655 1.2e-17 PFAM
Pfam:AA_permease 412 699 2e-42 PFAM
Pfam:SLC12 711 837 2.1e-19 PFAM
Pfam:SLC12 830 982 1.8e-20 PFAM
low complexity region 1001 1025 N/A INTRINSIC
Pfam:SLC12 1032 1138 2.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] K-Cl cotransporters are proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The protein encoded by this gene is an integral membrane K-Cl cotransporter that can function in either a net efflux or influx pathway, depending on the chemical concentration gradients of potassium and chloride. The encoded protein can act as a homomultimer, or as a heteromultimer with other K-Cl cotransporters, to maintain chloride homeostasis in neurons. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within a few minutes of birth of respiratory failure resulting from a motor nerve defect. Mice homozygous for a hypomorphic allele display postnatal lethality and tonic-clonic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Abca15 A T 7: 120,360,904 T637S possibly damaging Het
Adgrv1 T C 13: 81,561,469 K1135R possibly damaging Het
Afap1l1 A T 18: 61,739,122 probably null Het
AI467606 A G 7: 127,092,837 S195G probably damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Cic T A 7: 25,273,451 V869E probably damaging Het
Cpsf2 A G 12: 101,983,463 D118G probably damaging Het
Csnk1g1 A G 9: 66,002,230 S210G probably damaging Het
Cyp2c40 T A 19: 39,786,780 M343L probably benign Het
Cyp4a12b A T 4: 115,433,503 D274V possibly damaging Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah3 C T 7: 119,951,909 M3062I probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Elavl2 A T 4: 91,253,450 S278R possibly damaging Het
Emilin2 T C 17: 71,274,955 S259G probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Faim2 G A 15: 99,514,433 T140I probably damaging Het
Fbxo21 T C 5: 117,976,966 S56P probably benign Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Foxj2 A T 6: 122,840,241 H509L probably benign Het
Fth1 T A 19: 9,984,212 L49Q probably damaging Het
Gbp11 C A 5: 105,328,584 E220* probably null Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm1527 C A 3: 28,926,647 T632N probably benign Het
Gm4787 A T 12: 81,378,920 S155T probably benign Het
Gm9573 T A 17: 35,621,405 probably benign Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Helb T C 10: 120,105,766 Y339C probably benign Het
Hs3st4 A G 7: 124,397,013 I301V probably benign Het
Hunk A G 16: 90,493,480 D382G probably damaging Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il10 T C 1: 131,020,033 L41P probably damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Krt90 T C 15: 101,558,359 E263G probably benign Het
Lama2 C T 10: 27,164,926 C1467Y probably damaging Het
Med24 A G 11: 98,715,646 L330P probably damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Mtcl1 T C 17: 66,346,355 R1065G probably damaging Het
Mtmr14 G A 6: 113,240,361 G38D probably damaging Het
Mtus1 T C 8: 41,082,708 E657G probably damaging Het
Myo5c A T 9: 75,281,868 Q1020L probably benign Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nckap1 T C 2: 80,570,150 K69R probably damaging Het
Nlrp1b T C 11: 71,161,086 N1012D probably benign Het
Ntrk2 A C 13: 58,859,297 K238Q probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr667 T C 7: 104,916,775 N174D probably benign Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pfpl C T 19: 12,429,873 S496L probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pkhd1l1 A T 15: 44,550,752 H2805L possibly damaging Het
Pla2g4a T C 1: 149,840,676 N678S possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Polr1a T G 6: 71,936,285 probably null Het
Prl3d3 A C 13: 27,162,321 E180D probably benign Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Prpf3 A T 3: 95,844,239 D383E probably benign Het
Psmc4 A T 7: 28,048,897 L73H probably damaging Het
Rapgef3 C A 15: 97,766,961 G7V probably damaging Het
Rasl12 G A 9: 65,410,824 G157R probably damaging Het
Rnf38 A C 4: 44,149,098 V83G probably damaging Het
Rnls A C 19: 33,202,544 S51A probably benign Het
Siglecf A G 7: 43,352,380 T205A possibly damaging Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Spata13 GTTAGGCT GT 14: 60,760,871 probably benign Het
Specc1 T G 11: 62,118,296 S293A probably benign Het
Speer2 T G 16: 69,860,497 Q86P probably benign Het
Tbc1d15 T C 10: 115,229,173 D169G probably benign Het
Tbx20 C A 9: 24,769,771 E142* probably null Het
Tcp1 T A 17: 12,920,812 L199H probably damaging Het
Tex26 A T 5: 149,439,739 R5W probably damaging Het
Tg C A 15: 66,828,553 A120E probably damaging Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tmem57 A T 4: 134,828,279 N294K possibly damaging Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ush1c T C 7: 46,229,481 Y74C probably damaging Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Vps54 C T 11: 21,277,955 T176I probably damaging Het
Wdr95 T C 5: 149,579,162 probably null Het
Zfp81 T C 17: 33,335,304 T179A probably benign Het
Other mutations in Slc12a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Slc12a5 APN 2 164997121 missense probably damaging 1.00
IGL00425:Slc12a5 APN 2 164983281 missense probably damaging 1.00
IGL00976:Slc12a5 APN 2 164979304 missense probably damaging 1.00
IGL01654:Slc12a5 APN 2 164973755 missense possibly damaging 0.91
IGL01905:Slc12a5 APN 2 164990381 missense probably benign 0.02
IGL02205:Slc12a5 APN 2 164996479 missense probably benign 0.03
IGL02510:Slc12a5 APN 2 164982808 splice site probably benign
IGL02746:Slc12a5 APN 2 164974916 missense probably benign 0.01
R0051:Slc12a5 UTSW 2 164986663 missense probably damaging 1.00
R0254:Slc12a5 UTSW 2 164997245 critical splice donor site probably null
R0412:Slc12a5 UTSW 2 164994062 missense probably benign 0.05
R0587:Slc12a5 UTSW 2 164976533 missense probably damaging 1.00
R0835:Slc12a5 UTSW 2 164994038 missense probably damaging 0.97
R0932:Slc12a5 UTSW 2 164996885 splice site probably benign
R1643:Slc12a5 UTSW 2 164994027 missense probably benign 0.01
R1700:Slc12a5 UTSW 2 164992376 missense possibly damaging 0.94
R1760:Slc12a5 UTSW 2 164996128 missense probably damaging 0.99
R2293:Slc12a5 UTSW 2 164992330 missense probably benign 0.03
R2412:Slc12a5 UTSW 2 164976462 critical splice donor site probably null
R3035:Slc12a5 UTSW 2 164980258 missense probably benign 0.06
R3116:Slc12a5 UTSW 2 164996181 intron probably null
R3412:Slc12a5 UTSW 2 164968431 missense probably benign 0.26
R3788:Slc12a5 UTSW 2 164993775 missense probably damaging 1.00
R4039:Slc12a5 UTSW 2 164992330 missense probably benign 0.03
R4174:Slc12a5 UTSW 2 164979490 missense probably damaging 1.00
R4492:Slc12a5 UTSW 2 164979343 missense probably benign 0.08
R4608:Slc12a5 UTSW 2 164973765 missense probably damaging 0.99
R4750:Slc12a5 UTSW 2 164982931 missense probably benign 0.06
R4994:Slc12a5 UTSW 2 164983365 intron probably null
R5103:Slc12a5 UTSW 2 164992433 missense probably damaging 1.00
R5539:Slc12a5 UTSW 2 164987206 missense possibly damaging 0.94
R5632:Slc12a5 UTSW 2 164987221 missense possibly damaging 0.86
R5771:Slc12a5 UTSW 2 164973768 missense possibly damaging 0.88
R6139:Slc12a5 UTSW 2 164992311 missense probably damaging 0.98
R6336:Slc12a5 UTSW 2 164992464 intron probably null
R6581:Slc12a5 UTSW 2 164987115 missense probably damaging 1.00
R6706:Slc12a5 UTSW 2 164988589 missense probably damaging 1.00
R6886:Slc12a5 UTSW 2 164982905 missense probably benign
R7134:Slc12a5 UTSW 2 164974958 missense probably damaging 1.00
R7310:Slc12a5 UTSW 2 164992440 missense probably damaging 1.00
R7402:Slc12a5 UTSW 2 164982932 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGGTTTCTAGGGTCCCTCC -3'
(R):5'- TTTCATCCCAGGCTAGAGGACC -3'

Sequencing Primer
(F):5'- CATTGCCCAGCTTGGAGTG -3'
(R):5'- GCTAGAGGACCCACGTAATG -3'
Posted On2014-09-17