Incidental Mutation 'R2063:Invs'
ID 228825
Institutional Source Beutler Lab
Gene Symbol Invs
Ensembl Gene ENSMUSG00000028344
Gene Name inversin
Synonyms
MMRRC Submission 040068-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.717) question?
Stock # R2063 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 48279760-48431954 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 48396287 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 320 (L320Q)
Ref Sequence ENSEMBL: ENSMUSP00000030029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030029] [ENSMUST00000143433]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030029
AA Change: L320Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030029
Gene: ENSMUSG00000028344
AA Change: L320Q

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 148 177 6.46e-4 SMART
ANK 181 215 3.44e1 SMART
ANK 220 250 1.11e-2 SMART
ANK 254 285 2.07e-2 SMART
ANK 288 317 3.18e-3 SMART
ANK 321 350 3.91e-3 SMART
ANK 356 385 2.28e-4 SMART
ANK 389 418 8.39e-3 SMART
ANK 422 451 3.76e-5 SMART
ANK 455 484 2.45e-4 SMART
ANK 488 517 1.31e-4 SMART
ANK 523 553 6.71e-2 SMART
IQ 554 576 5.75e-2 SMART
low complexity region 589 607 N/A INTRINSIC
IQ 913 935 2.46e-1 SMART
low complexity region 973 989 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129480
Predicted Effect probably damaging
Transcript: ENSMUST00000143433
AA Change: L264Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138580
Gene: ENSMUSG00000028344
AA Change: L264Q

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 164 194 1.11e-2 SMART
ANK 198 229 2.07e-2 SMART
ANK 232 261 3.18e-3 SMART
ANK 265 294 3.91e-3 SMART
ANK 300 329 2.28e-4 SMART
ANK 333 362 8.39e-3 SMART
ANK 366 395 3.76e-5 SMART
ANK 399 428 2.45e-4 SMART
Meta Mutation Damage Score 0.1545 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Transgenic mice homozygous for an insertional mutation exhibit complete inversion of the L-R body axis, reversal of embryo turning, complex cardiac anomalies, an abnormally slow turbulent leftward nodal flow, and renal cyst formation. Most succumb to renal failure within 1 week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Abca15 A T 7: 120,360,904 T637S possibly damaging Het
Adgrv1 T C 13: 81,561,469 K1135R possibly damaging Het
Afap1l1 A T 18: 61,739,122 probably null Het
AI467606 A G 7: 127,092,837 S195G probably damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Cic T A 7: 25,273,451 V869E probably damaging Het
Cpsf2 A G 12: 101,983,463 D118G probably damaging Het
Csnk1g1 A G 9: 66,002,230 S210G probably damaging Het
Cyp2c40 T A 19: 39,786,780 M343L probably benign Het
Cyp4a12b A T 4: 115,433,503 D274V possibly damaging Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah3 C T 7: 119,951,909 M3062I probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Elavl2 A T 4: 91,253,450 S278R possibly damaging Het
Emilin2 T C 17: 71,274,955 S259G probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Faim2 G A 15: 99,514,433 T140I probably damaging Het
Fbxo21 T C 5: 117,976,966 S56P probably benign Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Foxj2 A T 6: 122,840,241 H509L probably benign Het
Fth1 T A 19: 9,984,212 L49Q probably damaging Het
Gbp11 C A 5: 105,328,584 E220* probably null Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm1527 C A 3: 28,926,647 T632N probably benign Het
Gm4787 A T 12: 81,378,920 S155T probably benign Het
Gm9573 T A 17: 35,621,405 probably benign Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Helb T C 10: 120,105,766 Y339C probably benign Het
Hs3st4 A G 7: 124,397,013 I301V probably benign Het
Hunk A G 16: 90,493,480 D382G probably damaging Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il10 T C 1: 131,020,033 L41P probably damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Krt90 T C 15: 101,558,359 E263G probably benign Het
Lama2 C T 10: 27,164,926 C1467Y probably damaging Het
Med24 A G 11: 98,715,646 L330P probably damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Mtcl1 T C 17: 66,346,355 R1065G probably damaging Het
Mtmr14 G A 6: 113,240,361 G38D probably damaging Het
Mtus1 T C 8: 41,082,708 E657G probably damaging Het
Myo5c A T 9: 75,281,868 Q1020L probably benign Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nckap1 T C 2: 80,570,150 K69R probably damaging Het
Nlrp1b T C 11: 71,161,086 N1012D probably benign Het
Ntrk2 A C 13: 58,859,297 K238Q probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr667 T C 7: 104,916,775 N174D probably benign Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pfpl C T 19: 12,429,873 S496L probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pkhd1l1 A T 15: 44,550,752 H2805L possibly damaging Het
Pla2g4a T C 1: 149,840,676 N678S possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Polr1a T G 6: 71,936,285 probably null Het
Prl3d3 A C 13: 27,162,321 E180D probably benign Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Prpf3 A T 3: 95,844,239 D383E probably benign Het
Psmc4 A T 7: 28,048,897 L73H probably damaging Het
Rapgef3 C A 15: 97,766,961 G7V probably damaging Het
Rasl12 G A 9: 65,410,824 G157R probably damaging Het
Rnf38 A C 4: 44,149,098 V83G probably damaging Het
Rnls A C 19: 33,202,544 S51A probably benign Het
Siglecf A G 7: 43,352,380 T205A possibly damaging Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc12a5 C T 2: 164,997,147 R1072W probably damaging Het
Spata13 GTTAGGCT GT 14: 60,760,871 probably benign Het
Specc1 T G 11: 62,118,296 S293A probably benign Het
Speer2 T G 16: 69,860,497 Q86P probably benign Het
Tbc1d15 T C 10: 115,229,173 D169G probably benign Het
Tbx20 C A 9: 24,769,771 E142* probably null Het
Tcp1 T A 17: 12,920,812 L199H probably damaging Het
Tex26 A T 5: 149,439,739 R5W probably damaging Het
Tg C A 15: 66,828,553 A120E probably damaging Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tmem57 A T 4: 134,828,279 N294K possibly damaging Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ush1c T C 7: 46,229,481 Y74C probably damaging Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Vps54 C T 11: 21,277,955 T176I probably damaging Het
Wdr95 T C 5: 149,579,162 probably null Het
Zfp81 T C 17: 33,335,304 T179A probably benign Het
Other mutations in Invs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Invs APN 4 48402909 missense probably damaging 0.98
IGL00487:Invs APN 4 48407689 nonsense probably null
IGL01487:Invs APN 4 48398136 missense probably benign 0.26
IGL01696:Invs APN 4 48425997 missense probably damaging 1.00
IGL02238:Invs APN 4 48390029 missense probably damaging 1.00
IGL03286:Invs APN 4 48382261 missense probably benign 0.26
R0645:Invs UTSW 4 48407653 missense probably benign 0.00
R0661:Invs UTSW 4 48421861 missense probably benign
R0698:Invs UTSW 4 48396364 missense probably benign 0.04
R0763:Invs UTSW 4 48392628 missense possibly damaging 0.82
R1183:Invs UTSW 4 48421725 missense possibly damaging 0.68
R1381:Invs UTSW 4 48421942 nonsense probably null
R1511:Invs UTSW 4 48382148 missense possibly damaging 0.82
R1843:Invs UTSW 4 48422035 missense probably damaging 0.96
R1903:Invs UTSW 4 48402824 splice site probably null
R1928:Invs UTSW 4 48390095 missense probably damaging 1.00
R1990:Invs UTSW 4 48392599 missense possibly damaging 0.88
R2064:Invs UTSW 4 48396287 missense probably damaging 1.00
R2065:Invs UTSW 4 48396287 missense probably damaging 1.00
R2066:Invs UTSW 4 48396287 missense probably damaging 1.00
R4744:Invs UTSW 4 48397609 missense probably damaging 1.00
R4997:Invs UTSW 4 48396332 missense probably damaging 0.98
R5011:Invs UTSW 4 48421807 missense probably damaging 1.00
R5013:Invs UTSW 4 48421807 missense probably damaging 1.00
R5083:Invs UTSW 4 48396307 missense possibly damaging 0.90
R5184:Invs UTSW 4 48283242 utr 5 prime probably benign
R5258:Invs UTSW 4 48396374 missense possibly damaging 0.82
R5375:Invs UTSW 4 48385262 missense probably benign 0.12
R5509:Invs UTSW 4 48396337 missense probably damaging 1.00
R5560:Invs UTSW 4 48416084 missense probably benign 0.00
R5748:Invs UTSW 4 48307823 missense probably damaging 0.98
R5813:Invs UTSW 4 48398146 missense probably damaging 0.98
R5840:Invs UTSW 4 48396284 missense probably damaging 1.00
R5984:Invs UTSW 4 48421674 missense probably benign 0.00
R6513:Invs UTSW 4 48397534 missense possibly damaging 0.46
R6637:Invs UTSW 4 48416203 splice site probably null
R6667:Invs UTSW 4 48402870 missense possibly damaging 0.66
R6838:Invs UTSW 4 48283278 missense possibly damaging 0.95
R6921:Invs UTSW 4 48396260 missense possibly damaging 0.46
R6945:Invs UTSW 4 48421785 missense probably benign 0.00
R7102:Invs UTSW 4 48407674 missense probably benign 0.21
R7142:Invs UTSW 4 48407696 missense probably damaging 1.00
R7263:Invs UTSW 4 48396381 missense probably damaging 1.00
R7283:Invs UTSW 4 48392526 splice site probably null
R7461:Invs UTSW 4 48392668 missense probably damaging 1.00
R7503:Invs UTSW 4 48396347 missense probably damaging 0.96
R7581:Invs UTSW 4 48421909 missense probably benign 0.00
R7613:Invs UTSW 4 48392668 missense probably damaging 1.00
R7861:Invs UTSW 4 48397559 missense possibly damaging 0.50
R8316:Invs UTSW 4 48426199 missense possibly damaging 0.68
R8321:Invs UTSW 4 48283267 missense probably benign 0.13
R8500:Invs UTSW 4 48422109 missense probably damaging 1.00
R8544:Invs UTSW 4 48397598 missense probably damaging 0.96
R9171:Invs UTSW 4 48398149 missense possibly damaging 0.90
R9663:Invs UTSW 4 48426218 missense probably damaging 1.00
X0026:Invs UTSW 4 48398221 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCCCAAATGTAATGGTGTTGC -3'
(R):5'- AACTTGGTGGCACCTTTCAGC -3'

Sequencing Primer
(F):5'- CCCAAATGTAATGGTGTTGCATGAG -3'
(R):5'- GCACCTTTCAGCACCCG -3'
Posted On 2014-09-17