Incidental Mutation 'R2063:Cic'
ID228849
Institutional Source Beutler Lab
Gene Symbol Cic
Ensembl Gene ENSMUSG00000005442
Gene Namecapicua transcriptional repressor
Synonyms1200010B10Rik
MMRRC Submission 040068-MU
Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R2063 (G1)
Quality Score151
Status Not validated
Chromosome7
Chromosomal Location25267704-25294159 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25273451 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 869 (V869E)
Ref Sequence ENSEMBL: ENSMUSP00000132351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169266] [ENSMUST00000169392]
Predicted Effect probably damaging
Transcript: ENSMUST00000169266
AA Change: V869E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: V869E

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
Pfam:DUF4819 249 346 1.8e-23 PFAM
low complexity region 351 367 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 779 786 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
PDB:4J2L|D 930 955 5e-10 PDB
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1031 1045 N/A INTRINSIC
HMG 1106 1176 1.24e-17 SMART
low complexity region 1322 1338 N/A INTRINSIC
low complexity region 1380 1393 N/A INTRINSIC
low complexity region 1415 1428 N/A INTRINSIC
low complexity region 1432 1462 N/A INTRINSIC
low complexity region 1474 1490 N/A INTRINSIC
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1689 1710 N/A INTRINSIC
low complexity region 1744 1766 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
low complexity region 1971 1986 N/A INTRINSIC
low complexity region 2024 2038 N/A INTRINSIC
low complexity region 2041 2061 N/A INTRINSIC
low complexity region 2129 2159 N/A INTRINSIC
low complexity region 2186 2219 N/A INTRINSIC
low complexity region 2311 2324 N/A INTRINSIC
low complexity region 2389 2400 N/A INTRINSIC
low complexity region 2430 2453 N/A INTRINSIC
low complexity region 2474 2509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169392
SMART Domains Protein: ENSMUSP00000131680
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169743
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]
Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Abca15 A T 7: 120,360,904 T637S possibly damaging Het
Adgrv1 T C 13: 81,561,469 K1135R possibly damaging Het
Afap1l1 A T 18: 61,739,122 probably null Het
AI467606 A G 7: 127,092,837 S195G probably damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Cpsf2 A G 12: 101,983,463 D118G probably damaging Het
Csnk1g1 A G 9: 66,002,230 S210G probably damaging Het
Cyp2c40 T A 19: 39,786,780 M343L probably benign Het
Cyp4a12b A T 4: 115,433,503 D274V possibly damaging Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah3 C T 7: 119,951,909 M3062I probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Elavl2 A T 4: 91,253,450 S278R possibly damaging Het
Emilin2 T C 17: 71,274,955 S259G probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Faim2 G A 15: 99,514,433 T140I probably damaging Het
Fbxo21 T C 5: 117,976,966 S56P probably benign Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Foxj2 A T 6: 122,840,241 H509L probably benign Het
Fth1 T A 19: 9,984,212 L49Q probably damaging Het
Gbp11 C A 5: 105,328,584 E220* probably null Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm1527 C A 3: 28,926,647 T632N probably benign Het
Gm4787 A T 12: 81,378,920 S155T probably benign Het
Gm9573 T A 17: 35,621,405 probably benign Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Helb T C 10: 120,105,766 Y339C probably benign Het
Hs3st4 A G 7: 124,397,013 I301V probably benign Het
Hunk A G 16: 90,493,480 D382G probably damaging Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il10 T C 1: 131,020,033 L41P probably damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Krt90 T C 15: 101,558,359 E263G probably benign Het
Lama2 C T 10: 27,164,926 C1467Y probably damaging Het
Med24 A G 11: 98,715,646 L330P probably damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Mtcl1 T C 17: 66,346,355 R1065G probably damaging Het
Mtmr14 G A 6: 113,240,361 G38D probably damaging Het
Mtus1 T C 8: 41,082,708 E657G probably damaging Het
Myo5c A T 9: 75,281,868 Q1020L probably benign Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nckap1 T C 2: 80,570,150 K69R probably damaging Het
Nlrp1b T C 11: 71,161,086 N1012D probably benign Het
Ntrk2 A C 13: 58,859,297 K238Q probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr667 T C 7: 104,916,775 N174D probably benign Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pfpl C T 19: 12,429,873 S496L probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pkhd1l1 A T 15: 44,550,752 H2805L possibly damaging Het
Pla2g4a T C 1: 149,840,676 N678S possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Polr1a T G 6: 71,936,285 probably null Het
Prl3d3 A C 13: 27,162,321 E180D probably benign Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Prpf3 A T 3: 95,844,239 D383E probably benign Het
Psmc4 A T 7: 28,048,897 L73H probably damaging Het
Rapgef3 C A 15: 97,766,961 G7V probably damaging Het
Rasl12 G A 9: 65,410,824 G157R probably damaging Het
Rnf38 A C 4: 44,149,098 V83G probably damaging Het
Rnls A C 19: 33,202,544 S51A probably benign Het
Siglecf A G 7: 43,352,380 T205A possibly damaging Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc12a5 C T 2: 164,997,147 R1072W probably damaging Het
Spata13 GTTAGGCT GT 14: 60,760,871 probably benign Het
Specc1 T G 11: 62,118,296 S293A probably benign Het
Speer2 T G 16: 69,860,497 Q86P probably benign Het
Tbc1d15 T C 10: 115,229,173 D169G probably benign Het
Tbx20 C A 9: 24,769,771 E142* probably null Het
Tcp1 T A 17: 12,920,812 L199H probably damaging Het
Tex26 A T 5: 149,439,739 R5W probably damaging Het
Tg C A 15: 66,828,553 A120E probably damaging Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tmem57 A T 4: 134,828,279 N294K possibly damaging Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ush1c T C 7: 46,229,481 Y74C probably damaging Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Vps54 C T 11: 21,277,955 T176I probably damaging Het
Wdr95 T C 5: 149,579,162 probably null Het
Zfp81 T C 17: 33,335,304 T179A probably benign Het
Other mutations in Cic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cic APN 7 25292124 missense probably damaging 1.00
IGL01668:Cic APN 7 25291204 missense possibly damaging 0.47
IGL02229:Cic APN 7 25290950 missense probably damaging 0.96
IGL02506:Cic APN 7 25290857 missense probably benign
IGL02794:Cic APN 7 25285644 missense probably damaging 1.00
IGL03065:Cic APN 7 25285821 splice site probably benign
IGL03304:Cic APN 7 25284849 missense probably damaging 1.00
Capuccino UTSW 7 25287140 missense probably damaging 0.98
Cassock UTSW 7 25288913 nonsense probably null
Monkey UTSW 7 25287141 missense probably damaging 1.00
1mM(1):Cic UTSW 7 25290789 splice site probably benign
IGL03046:Cic UTSW 7 25291075 missense probably damaging 1.00
R0012:Cic UTSW 7 25287140 missense probably damaging 0.98
R0012:Cic UTSW 7 25287141 missense probably damaging 1.00
R0027:Cic UTSW 7 25287140 missense probably damaging 0.98
R0027:Cic UTSW 7 25287141 missense probably damaging 1.00
R0038:Cic UTSW 7 25287140 missense probably damaging 0.98
R0038:Cic UTSW 7 25287141 missense probably damaging 1.00
R0063:Cic UTSW 7 25287140 missense probably damaging 0.98
R0063:Cic UTSW 7 25287141 missense probably damaging 1.00
R0064:Cic UTSW 7 25287140 missense probably damaging 0.98
R0064:Cic UTSW 7 25287141 missense probably damaging 1.00
R0118:Cic UTSW 7 25286034 missense probably damaging 1.00
R0193:Cic UTSW 7 25287140 missense probably damaging 0.98
R0193:Cic UTSW 7 25287141 missense probably damaging 1.00
R0241:Cic UTSW 7 25287140 missense probably damaging 0.98
R0241:Cic UTSW 7 25287141 missense probably damaging 1.00
R0377:Cic UTSW 7 25285799 missense probably damaging 0.98
R0462:Cic UTSW 7 25287140 missense probably damaging 0.98
R0462:Cic UTSW 7 25287141 missense probably damaging 1.00
R0800:Cic UTSW 7 25285237 missense probably benign
R1253:Cic UTSW 7 25290948 missense probably damaging 1.00
R1458:Cic UTSW 7 25279737 intron probably benign
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1519:Cic UTSW 7 25293810 critical splice acceptor site probably null
R1586:Cic UTSW 7 25285961 missense probably damaging 1.00
R1824:Cic UTSW 7 25288266 missense probably damaging 1.00
R1908:Cic UTSW 7 25286840 missense probably damaging 1.00
R2045:Cic UTSW 7 25271536 missense possibly damaging 0.53
R2161:Cic UTSW 7 25288134 splice site probably null
R2495:Cic UTSW 7 25291776 splice site probably benign
R2865:Cic UTSW 7 25273221 missense probably damaging 0.96
R3692:Cic UTSW 7 25288913 nonsense probably null
R3709:Cic UTSW 7 25286981 missense probably damaging 0.99
R3710:Cic UTSW 7 25286981 missense probably damaging 0.99
R3872:Cic UTSW 7 25271699 missense possibly damaging 0.92
R3946:Cic UTSW 7 25272346 missense possibly damaging 0.93
R4199:Cic UTSW 7 25291670 frame shift probably null
R4426:Cic UTSW 7 25294008 utr 3 prime probably benign
R4502:Cic UTSW 7 25288467 missense probably damaging 1.00
R4585:Cic UTSW 7 25272778 missense probably benign 0.33
R4586:Cic UTSW 7 25272778 missense probably benign 0.33
R4614:Cic UTSW 7 25291670 frame shift probably null
R4664:Cic UTSW 7 25290674 small deletion probably benign
R4688:Cic UTSW 7 25291670 frame shift probably null
R4695:Cic UTSW 7 25273588 missense possibly damaging 0.72
R4696:Cic UTSW 7 25288483 missense probably benign
R4746:Cic UTSW 7 25288480 missense probably damaging 1.00
R4758:Cic UTSW 7 25292211 missense possibly damaging 0.62
R4767:Cic UTSW 7 25271600 missense possibly damaging 0.92
R4776:Cic UTSW 7 25282883 missense possibly damaging 0.95
R4820:Cic UTSW 7 25271732 missense possibly damaging 0.92
R4850:Cic UTSW 7 25272902 missense probably damaging 0.98
R4851:Cic UTSW 7 25272902 missense probably damaging 0.98
R4922:Cic UTSW 7 25291670 small insertion probably benign
R4989:Cic UTSW 7 25287110 missense probably damaging 1.00
R5131:Cic UTSW 7 25291670 small insertion probably benign
R5718:Cic UTSW 7 25272778 missense probably benign 0.33
R5801:Cic UTSW 7 25271438 missense possibly damaging 0.93
R5949:Cic UTSW 7 25272305 missense probably damaging 1.00
R6000:Cic UTSW 7 25271998 missense probably benign 0.33
R6246:Cic UTSW 7 25271642 missense probably damaging 1.00
R6283:Cic UTSW 7 25286034 missense probably damaging 1.00
R6364:Cic UTSW 7 25272823 missense possibly damaging 0.72
R6481:Cic UTSW 7 25288281 missense possibly damaging 0.56
R6919:Cic UTSW 7 25271777 missense probably benign 0.04
R6920:Cic UTSW 7 25290682 missense probably damaging 1.00
R6995:Cic UTSW 7 25271311 missense possibly damaging 0.53
R7002:Cic UTSW 7 25272196 missense probably damaging 0.99
R7113:Cic UTSW 7 25273444 missense probably benign 0.08
R7560:Cic UTSW 7 25272853 missense probably damaging 0.98
R7680:Cic UTSW 7 25292431 missense probably damaging 0.96
R7698:Cic UTSW 7 25273172 missense possibly damaging 0.72
R7746:Cic UTSW 7 25288782 missense probably damaging 1.00
R7841:Cic UTSW 7 25285767 missense probably damaging 1.00
R7879:Cic UTSW 7 25285126 missense probably benign 0.10
R7916:Cic UTSW 7 25288290 missense probably damaging 0.99
R7920:Cic UTSW 7 25271959 missense probably benign
R8056:Cic UTSW 7 25290941 missense possibly damaging 0.90
R8226:Cic UTSW 7 25287788 missense probably damaging 1.00
R8281:Cic UTSW 7 25271824 missense probably benign
V7732:Cic UTSW 7 25292245 missense probably benign
Z1176:Cic UTSW 7 25271019 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACCTGTCATTGTCCGCAAC -3'
(R):5'- TCATCACCCTTGAAAGCCCG -3'

Sequencing Primer
(F):5'- ATTGTCCGCAACCCCGATG -3'
(R):5'- TTGAAAGCCCGGCTCCAAC -3'
Posted On2014-09-17