Incidental Mutation 'R2063:Mtus1'
ID228858
Institutional Source Beutler Lab
Gene Symbol Mtus1
Ensembl Gene ENSMUSG00000045636
Gene Namemitochondrial tumor suppressor 1
SynonymsB430305I03Rik, MD44, MTSG1, Atip1
MMRRC Submission 040068-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R2063 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location40990914-41133726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41082708 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 657 (E657G)
Ref Sequence ENSEMBL: ENSMUSP00000112626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059115] [ENSMUST00000118835] [ENSMUST00000145860] [ENSMUST00000155055]
Predicted Effect probably damaging
Transcript: ENSMUST00000059115
AA Change: E657G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059503
Gene: ENSMUSG00000045636
AA Change: E657G

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
coiled coil region 876 938 N/A INTRINSIC
SCOP:d1eq1a_ 1021 1156 3e-7 SMART
low complexity region 1195 1209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118835
AA Change: E657G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112626
Gene: ENSMUSG00000045636
AA Change: E657G

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
coiled coil region 876 938 N/A INTRINSIC
SCOP:d1eq1a_ 1021 1156 3e-7 SMART
low complexity region 1195 1209 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000143853
AA Change: E23G
Predicted Effect probably damaging
Transcript: ENSMUST00000145860
AA Change: E657G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119440
Gene: ENSMUSG00000045636
AA Change: E657G

DomainStartEndE-ValueType
low complexity region 524 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155055
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a C-terminal domain able to interact with the angiotension II (AT2) receptor and a large coiled-coil region allowing dimerization. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. One of the transcript variants has been shown to encode a mitochondrial protein that acts as a tumor suppressor and partcipates in AT2 signaling pathways. Other variants may encode nuclear or transmembrane proteins but it has not been determined whether they also participate in AT2 signaling pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit spontaneous heart hypertrophy and SLE-like lymphoproliferative disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Abca15 A T 7: 120,360,904 T637S possibly damaging Het
Adgrv1 T C 13: 81,561,469 K1135R possibly damaging Het
Afap1l1 A T 18: 61,739,122 probably null Het
AI467606 A G 7: 127,092,837 S195G probably damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Cic T A 7: 25,273,451 V869E probably damaging Het
Cpsf2 A G 12: 101,983,463 D118G probably damaging Het
Csnk1g1 A G 9: 66,002,230 S210G probably damaging Het
Cyp2c40 T A 19: 39,786,780 M343L probably benign Het
Cyp4a12b A T 4: 115,433,503 D274V possibly damaging Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah3 C T 7: 119,951,909 M3062I probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Elavl2 A T 4: 91,253,450 S278R possibly damaging Het
Emilin2 T C 17: 71,274,955 S259G probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Faim2 G A 15: 99,514,433 T140I probably damaging Het
Fbxo21 T C 5: 117,976,966 S56P probably benign Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Foxj2 A T 6: 122,840,241 H509L probably benign Het
Fth1 T A 19: 9,984,212 L49Q probably damaging Het
Gbp11 C A 5: 105,328,584 E220* probably null Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm1527 C A 3: 28,926,647 T632N probably benign Het
Gm4787 A T 12: 81,378,920 S155T probably benign Het
Gm9573 T A 17: 35,621,405 probably benign Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Helb T C 10: 120,105,766 Y339C probably benign Het
Hs3st4 A G 7: 124,397,013 I301V probably benign Het
Hunk A G 16: 90,493,480 D382G probably damaging Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il10 T C 1: 131,020,033 L41P probably damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Krt90 T C 15: 101,558,359 E263G probably benign Het
Lama2 C T 10: 27,164,926 C1467Y probably damaging Het
Med24 A G 11: 98,715,646 L330P probably damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Mtcl1 T C 17: 66,346,355 R1065G probably damaging Het
Mtmr14 G A 6: 113,240,361 G38D probably damaging Het
Myo5c A T 9: 75,281,868 Q1020L probably benign Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nckap1 T C 2: 80,570,150 K69R probably damaging Het
Nlrp1b T C 11: 71,161,086 N1012D probably benign Het
Ntrk2 A C 13: 58,859,297 K238Q probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr667 T C 7: 104,916,775 N174D probably benign Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pfpl C T 19: 12,429,873 S496L probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pkhd1l1 A T 15: 44,550,752 H2805L possibly damaging Het
Pla2g4a T C 1: 149,840,676 N678S possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Polr1a T G 6: 71,936,285 probably null Het
Prl3d3 A C 13: 27,162,321 E180D probably benign Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Prpf3 A T 3: 95,844,239 D383E probably benign Het
Psmc4 A T 7: 28,048,897 L73H probably damaging Het
Rapgef3 C A 15: 97,766,961 G7V probably damaging Het
Rasl12 G A 9: 65,410,824 G157R probably damaging Het
Rnf38 A C 4: 44,149,098 V83G probably damaging Het
Rnls A C 19: 33,202,544 S51A probably benign Het
Siglecf A G 7: 43,352,380 T205A possibly damaging Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc12a5 C T 2: 164,997,147 R1072W probably damaging Het
Spata13 GTTAGGCT GT 14: 60,760,871 probably benign Het
Specc1 T G 11: 62,118,296 S293A probably benign Het
Speer2 T G 16: 69,860,497 Q86P probably benign Het
Tbc1d15 T C 10: 115,229,173 D169G probably benign Het
Tbx20 C A 9: 24,769,771 E142* probably null Het
Tcp1 T A 17: 12,920,812 L199H probably damaging Het
Tex26 A T 5: 149,439,739 R5W probably damaging Het
Tg C A 15: 66,828,553 A120E probably damaging Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tmem57 A T 4: 134,828,279 N294K possibly damaging Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ush1c T C 7: 46,229,481 Y74C probably damaging Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Vps54 C T 11: 21,277,955 T176I probably damaging Het
Wdr95 T C 5: 149,579,162 probably null Het
Zfp81 T C 17: 33,335,304 T179A probably benign Het
Other mutations in Mtus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mtus1 APN 8 41084349 missense probably damaging 1.00
IGL01377:Mtus1 APN 8 41083135 missense possibly damaging 0.94
IGL01472:Mtus1 APN 8 41002412 missense probably benign 0.01
IGL01995:Mtus1 APN 8 41084420 missense probably damaging 1.00
IGL02027:Mtus1 APN 8 40993601 missense probably damaging 1.00
IGL02381:Mtus1 APN 8 41083119 missense probably benign 0.05
IGL02571:Mtus1 APN 8 41083482 missense possibly damaging 0.90
IGL02936:Mtus1 APN 8 40999517 missense possibly damaging 0.79
R0116:Mtus1 UTSW 8 40998477 unclassified probably benign
R0139:Mtus1 UTSW 8 41016196 splice site probably benign
R0178:Mtus1 UTSW 8 41002361 missense possibly damaging 0.94
R0179:Mtus1 UTSW 8 41002361 missense possibly damaging 0.94
R0220:Mtus1 UTSW 8 40994572 missense probably damaging 1.00
R0324:Mtus1 UTSW 8 41084395 missense probably benign
R0355:Mtus1 UTSW 8 41082928 missense probably benign 0.02
R0357:Mtus1 UTSW 8 41083526 missense possibly damaging 0.71
R0464:Mtus1 UTSW 8 41002474 missense probably damaging 0.96
R0681:Mtus1 UTSW 8 40993517 missense probably damaging 1.00
R1016:Mtus1 UTSW 8 41050026 missense probably benign 0.43
R1570:Mtus1 UTSW 8 41076241 missense probably damaging 1.00
R1579:Mtus1 UTSW 8 41082858 missense probably damaging 1.00
R1607:Mtus1 UTSW 8 41015409 missense possibly damaging 0.58
R1869:Mtus1 UTSW 8 41076230 critical splice donor site probably null
R1888:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1888:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1891:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R1894:Mtus1 UTSW 8 41084325 missense probably damaging 0.96
R2111:Mtus1 UTSW 8 41022571 missense probably damaging 1.00
R2112:Mtus1 UTSW 8 41022571 missense probably damaging 1.00
R2224:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2226:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2227:Mtus1 UTSW 8 41082775 missense probably damaging 1.00
R2516:Mtus1 UTSW 8 41082739 missense probably damaging 1.00
R3414:Mtus1 UTSW 8 41048063 missense probably damaging 1.00
R3899:Mtus1 UTSW 8 41083129 missense probably benign
R4096:Mtus1 UTSW 8 41084247 missense probably damaging 0.99
R4831:Mtus1 UTSW 8 41083152 missense probably damaging 1.00
R4850:Mtus1 UTSW 8 41084470 missense possibly damaging 0.81
R4916:Mtus1 UTSW 8 41000801 missense probably damaging 1.00
R4940:Mtus1 UTSW 8 41041478 missense possibly damaging 0.52
R4988:Mtus1 UTSW 8 41084541 missense probably benign 0.05
R5133:Mtus1 UTSW 8 41083192 missense probably benign 0.00
R5468:Mtus1 UTSW 8 41084578 missense probably benign 0.00
R5598:Mtus1 UTSW 8 41022555 missense probably damaging 1.00
R5782:Mtus1 UTSW 8 41082727 missense probably damaging 1.00
R5860:Mtus1 UTSW 8 41076266 missense probably damaging 0.99
R5900:Mtus1 UTSW 8 41083497 missense possibly damaging 0.92
R5943:Mtus1 UTSW 8 41084265 missense probably benign 0.00
R6019:Mtus1 UTSW 8 41083040 missense probably benign 0.33
R6125:Mtus1 UTSW 8 41084539 missense probably damaging 0.99
R6197:Mtus1 UTSW 8 41084037 missense possibly damaging 0.90
R6488:Mtus1 UTSW 8 41041508 missense possibly damaging 0.52
R6869:Mtus1 UTSW 8 41082654 missense possibly damaging 0.71
R7117:Mtus1 UTSW 8 41083584 missense possibly damaging 0.95
R7126:Mtus1 UTSW 8 41015402 missense probably damaging 0.98
R7213:Mtus1 UTSW 8 41084487 missense probably damaging 0.99
R7308:Mtus1 UTSW 8 41082928 missense probably benign 0.02
R7424:Mtus1 UTSW 8 41022406 missense probably damaging 1.00
R7481:Mtus1 UTSW 8 41084615 missense probably damaging 0.99
R7485:Mtus1 UTSW 8 41084553 missense probably benign 0.37
R7660:Mtus1 UTSW 8 41016211 missense probably benign
R7699:Mtus1 UTSW 8 41083969 missense possibly damaging 0.94
R7700:Mtus1 UTSW 8 41083969 missense possibly damaging 0.94
R7709:Mtus1 UTSW 8 41054650 missense possibly damaging 0.81
R7791:Mtus1 UTSW 8 41083380 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACAAATTACGAACCAAGTTCAGGG -3'
(R):5'- CGGGGTTCCAAGAACAACATC -3'

Sequencing Primer
(F):5'- GGGATATTATTAGCAATTACAGGCC -3'
(R):5'- TCTGCCACGAAATCGAATCAGGAG -3'
Posted On2014-09-17