Mutagenetix > Incidental Mutation

Incidental Mutation 'R0157:Lamc1'

22887

Institutional Source

Beutler Lab

Gene Symbol

Lamc1

Ensembl Gene

ENSMUSG00000026478

Gene Name

laminin, gamma 1

Synonyms

laminin B2, Lamb2

MMRRC Submission

038437-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0157 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

153218922-153332786 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 153262607 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 167 (D167G)

Ref Sequence

ENSEMBL: ENSMUSP00000027752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027752]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000027752
AA Change: D167G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: D167G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
LamNT	42	282	1.97e-150	SMART
EGF_Lam	284	337	7.18e-7	SMART
EGF_Lam	340	393	7.93e-9	SMART
EGF_Lam	396	440	2.11e-13	SMART
EGF_Lam	443	490	2.87e-15	SMART
LamB	551	676	5.52e-48	SMART
Pfam:Laminin_EGF	683	718	1.3e-4	PFAM
EGF_Lam	722	768	2.38e-12	SMART
EGF_Lam	771	823	1.39e-4	SMART
EGF_Lam	826	879	8.05e-10	SMART
EGF_Lam	882	930	8.9e-12	SMART
EGF_Lam	933	978	1.26e-11	SMART
EGF_Lam	981	1026	7.4e-9	SMART
coiled coil region	1063	1594	N/A	INTRINSIC

Meta Mutation Damage Score

0.0816

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 88.5%

Validation Efficiency

64% (47/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adap2	T	A	11: 80,165,701	I180N	probably damaging	Het
Alk	T	A	17: 71,949,845	N673I	probably benign	Het
Ankrd7	T	C	6: 18,866,540	S20P	probably damaging	Het
Arhgef26	T	G	3: 62,380,971	D487E	probably damaging	Het
Arhgef4	A	G	1: 34,806,394	D1500G	probably damaging	Het
Arhgef7	A	G	8: 11,785,812	I39V	probably damaging	Het
Asap2	T	A	12: 21,206,325	I208N	probably damaging	Het
Atad5	T	C	11: 80,089,817	V16A	possibly damaging	Het
Atp2b1	T	C	10: 98,999,947	I518T	probably damaging	Het
B130006D01Rik	T	C	11: 95,726,385		probably benign	Het
BC028528	A	G	3: 95,884,968		probably null	Het
Bpifb6	T	A	2: 153,903,966	L74Q	probably benign	Het
Bptf	T	C	11: 107,074,658	T1122A	possibly damaging	Het
Cacna2d4	T	A	6: 119,312,424	D806E	probably benign	Het
Cdhr3	T	C	12: 33,061,650	Q287R	possibly damaging	Het
Cdk12	A	G	11: 98,249,776		probably benign	Het
Cenpf	T	A	1: 189,652,359	T2575S	probably benign	Het
Chd7	T	A	4: 8,833,759	I1171N	probably damaging	Het
Chd9	T	C	8: 91,008,836		probably null	Het
Ckmt1	A	G	2: 121,363,041	T361A	possibly damaging	Het
Clec4d	G	T	6: 123,267,136	R68L	probably benign	Het
Csmd2	G	T	4: 128,521,911	V2678F	probably benign	Het
Cul7	T	A	17: 46,653,835	V131E	possibly damaging	Het
Dab2	T	C	15: 6,429,827	S407P	probably benign	Het
Dnah17	C	T	11: 118,127,171	G166D	probably benign	Het
F13b	G	A	1: 139,503,847	V52I	probably benign	Het
Fam208b	C	A	13: 3,575,550	V1467L	probably benign	Het
Gjd4	T	C	18: 9,280,549	I176M	probably benign	Het
Gm13083	C	T	4: 143,615,796	P158S	probably damaging	Het
Gm4969	T	C	7: 19,107,020	H63R	possibly damaging	Het
Hoxc11	A	G	15: 102,955,001	Y159C	probably damaging	Het
Hydin	T	C	8: 110,300,010	I120T	possibly damaging	Het
Il20rb	A	G	9: 100,473,079	Y104H	probably damaging	Het
Krtap21-1	A	G	16: 89,403,542	C71R	unknown	Het
Lin7c	C	A	2: 109,895,169	A73E	probably damaging	Het
Mms22l	C	A	4: 24,588,224	A952E	probably damaging	Het
Myh3	A	G	11: 67,082,909	N136S	probably benign	Het
Ndufb10	T	C	17: 24,724,244	T31A	probably benign	Het
Nlrp2	T	C	7: 5,308,770	Y37C	possibly damaging	Het
Olfr1384	T	C	11: 49,513,773	I45T	probably damaging	Het
Olfr314	T	C	11: 58,787,059	F275S	probably damaging	Het
Orc3	C	A	4: 34,607,130		probably null	Het
Pard3b	A	C	1: 62,211,633	M512L	probably damaging	Het
Pcdh10	A	G	3: 45,379,701	D150G	probably damaging	Het
Pcolce	A	T	5: 137,610,479		probably null	Het
Pdcl	A	C	2: 37,352,177	I187S	probably damaging	Het
Pkn1	T	C	8: 83,692,820	I51M	probably damaging	Het
Pla2g4e	T	A	2: 120,170,181	T692S	probably benign	Het
Plcb2	C	A	2: 118,718,541	V380F	probably damaging	Het
Pmpcb	A	T	5: 21,742,952	I218F	probably damaging	Het
Pms1	A	T	1: 53,195,037	Y773*	probably null	Het
Polr2e	C	T	10: 80,036,781	G184R	probably damaging	Het
Polr3a	T	C	14: 24,479,186	I369V	probably damaging	Het
Prpf4b	T	C	13: 34,884,031		probably benign	Het
Pzp	G	A	6: 128,523,976	Q140*	probably null	Het
Qrich2	T	A	11: 116,441,395	E2325V	probably damaging	Het
R3hdm2	T	G	10: 127,471,989	L373R	probably damaging	Het
Sema3d	A	T	5: 12,508,137	D212V	possibly damaging	Het
Sidt2	A	G	9: 45,939,267	I850T	probably damaging	Het
Slc22a29	C	T	19: 8,162,742	R433H	possibly damaging	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Sox21	G	A	14: 118,235,942		probably benign	Het
Steap3	A	G	1: 120,227,649	*527R	probably null	Het
Svep1	T	C	4: 58,069,830	E2652G	possibly damaging	Het
Taar2	T	A	10: 23,941,491	F310I	probably damaging	Het
Tecta	A	G	9: 42,375,011	V783A	probably benign	Het
Vmn1r173	T	A	7: 23,702,397	I19N	probably damaging	Het
Vwa5b1	T	A	4: 138,604,879	M276L	probably benign	Het
Yeats2	A	C	16: 20,221,677	*142C	probably null	Het
Zfp26	G	T	9: 20,437,870	T466K	probably benign	Het
Zfp426	T	C	9: 20,471,136	N171S	probably benign	Het

Other mutations in Lamc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Lamc1	APN	1	153240495	missense	probably damaging	1.00
IGL01397:Lamc1	APN	1	153251134	missense	probably damaging	1.00
IGL01661:Lamc1	APN	1	153221573	missense	possibly damaging	0.89
IGL01894:Lamc1	APN	1	153247082	missense	possibly damaging	0.51
IGL02000:Lamc1	APN	1	153240433	missense	probably damaging	1.00
IGL02649:Lamc1	APN	1	153247042	missense	possibly damaging	0.78
IGL02749:Lamc1	APN	1	153249853	missense	possibly damaging	0.51
IGL02819:Lamc1	APN	1	153250661	missense	probably damaging	1.00
IGL02831:Lamc1	APN	1	153247055	missense	probably benign	0.00
IGL03069:Lamc1	APN	1	153239381	missense	probably damaging	1.00
IGL03143:Lamc1	APN	1	153332274	missense	probably benign	0.00
IGL03166:Lamc1	APN	1	153332301	missense	probably benign	0.01
IGL03285:Lamc1	APN	1	153227685	missense	possibly damaging	0.96
IGL03294:Lamc1	APN	1	153262646	missense	probably damaging	1.00
pride	UTSW	1	153247284	missense	probably benign	0.01
Stratum	UTSW	1	153251124	nonsense	probably null
tier	UTSW	1	153250522	missense	probably damaging	1.00
PIT4280001:Lamc1	UTSW	1	153243471	missense	probably damaging	1.00
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0027:Lamc1	UTSW	1	153262583	missense	probably damaging	1.00
R0060:Lamc1	UTSW	1	153241868	unclassified	probably benign
R0078:Lamc1	UTSW	1	153229190	missense	probably damaging	0.96
R0282:Lamc1	UTSW	1	153255312	missense	probably benign
R0374:Lamc1	UTSW	1	153251065	splice site	probably benign
R0494:Lamc1	UTSW	1	153246936	critical splice donor site	probably null
R0502:Lamc1	UTSW	1	153246932	splice site	probably benign
R0755:Lamc1	UTSW	1	153247450	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0791:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0792:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0792:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0792:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0892:Lamc1	UTSW	1	153332254	missense	possibly damaging	0.95
R0941:Lamc1	UTSW	1	153332274	missense	possibly damaging	0.72
R0961:Lamc1	UTSW	1	153221700	missense	probably benign	0.03
R0961:Lamc1	UTSW	1	153221646	frame shift	probably null
R0963:Lamc1	UTSW	1	153243386	missense	probably benign
R1127:Lamc1	UTSW	1	153250459	missense	possibly damaging	0.69
R1173:Lamc1	UTSW	1	153247231	splice site	probably benign
R1175:Lamc1	UTSW	1	153247231	splice site	probably benign
R1449:Lamc1	UTSW	1	153250495	missense	probably benign
R1481:Lamc1	UTSW	1	153221634	missense	probably damaging	1.00
R1565:Lamc1	UTSW	1	153242743	missense	probably benign	0.34
R1583:Lamc1	UTSW	1	153243478	critical splice acceptor site	probably null
R1643:Lamc1	UTSW	1	153258072	splice site	probably benign
R1652:Lamc1	UTSW	1	153249646	missense	probably damaging	1.00
R1691:Lamc1	UTSW	1	153247249	missense	probably benign	0.04
R1854:Lamc1	UTSW	1	153249872	missense	probably damaging	0.99
R2018:Lamc1	UTSW	1	153242632	missense	probably benign	0.07
R2170:Lamc1	UTSW	1	153249142	missense	probably benign	0.07
R2410:Lamc1	UTSW	1	153247395	missense	possibly damaging	0.61
R3438:Lamc1	UTSW	1	153226415	missense	probably benign	0.04
R3615:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3616:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3699:Lamc1	UTSW	1	153255205	missense	possibly damaging	0.79
R3811:Lamc1	UTSW	1	153262708	splice site	probably null
R4285:Lamc1	UTSW	1	153234552	missense	probably damaging	0.99
R4431:Lamc1	UTSW	1	153221528	missense	probably damaging	1.00
R4579:Lamc1	UTSW	1	153247269	missense	probably damaging	1.00
R4625:Lamc1	UTSW	1	153242696	missense	probably benign	0.04
R4649:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4650:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4651:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4652:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4653:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4784:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4785:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4853:Lamc1	UTSW	1	153229100	missense	possibly damaging	0.89
R5216:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5217:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5218:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5219:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5468:Lamc1	UTSW	1	153233564	missense	probably damaging	0.99
R5597:Lamc1	UTSW	1	153251970	missense	probably damaging	1.00
R5754:Lamc1	UTSW	1	153247284	missense	probably benign	0.01
R6233:Lamc1	UTSW	1	153223666	missense	probably benign
R6431:Lamc1	UTSW	1	153221671	missense	probably benign	0.21
R6636:Lamc1	UTSW	1	153241975	missense	possibly damaging	0.93
R6888:Lamc1	UTSW	1	153262492	missense	probably damaging	1.00
R7161:Lamc1	UTSW	1	153226454	missense	probably damaging	1.00
R7240:Lamc1	UTSW	1	153234650	missense	possibly damaging	0.82
R7388:Lamc1	UTSW	1	153249076	missense	probably damaging	1.00
R7474:Lamc1	UTSW	1	153332265	missense	possibly damaging	0.81
R7570:Lamc1	UTSW	1	153243275	missense	possibly damaging	0.64
R7583:Lamc1	UTSW	1	153243232	missense	possibly damaging	0.71
R7597:Lamc1	UTSW	1	153240454	missense	possibly damaging	0.94
R7635:Lamc1	UTSW	1	153249060	missense	probably damaging	1.00
R7976:Lamc1	UTSW	1	153247268	missense	probably damaging	1.00
R8012:Lamc1	UTSW	1	153221612	missense	probably benign	0.04
R8207:Lamc1	UTSW	1	153250522	missense	probably damaging	1.00
R8219:Lamc1	UTSW	1	153247327	missense	probably damaging	1.00
R8227:Lamc1	UTSW	1	153223754	missense	probably benign	0.04
R8315:Lamc1	UTSW	1	153243421	missense	probably benign	0.00
R8417:Lamc1	UTSW	1	153230769	missense	probably damaging	1.00
R8685:Lamc1	UTSW	1	153233542	missense	probably benign	0.31
R8827:Lamc1	UTSW	1	153221678	missense	probably damaging	1.00
R8995:Lamc1	UTSW	1	153332247	missense	probably benign	0.00
R9061:Lamc1	UTSW	1	153251124	nonsense	probably null
R9141:Lamc1	UTSW	1	153247450	missense	probably benign	0.01
R9187:Lamc1	UTSW	1	153221688	nonsense	probably null
R9206:Lamc1	UTSW	1	153250451	missense	probably damaging	1.00
R9222:Lamc1	UTSW	1	153243341	missense	probably damaging	0.96
R9297:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9318:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9377:Lamc1	UTSW	1	153239263	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTTGAAAAGGCCACGTTGCCAC -3'
(R):5'- GGGCAATTTCCAGGCTTAGACGAG -3'

Sequencing Primer
(F):5'- CCGGTGAGGGGGGAAATG -3'
(R):5'- CAGGCTTAGACGAGCCTAC -3'

Posted On

2013-04-16