Incidental Mutation 'R2063:Alox12e'
ID 228872
Institutional Source Beutler Lab
Gene Symbol Alox12e
Ensembl Gene ENSMUSG00000018907
Gene Name arachidonate lipoxygenase, epidermal
Synonyms 8-LOX, Aloxe, Alox12-ps2, e-LOX1, Alox12-ps1
MMRRC Submission 040068-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2063 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 70206436-70213454 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 70206828 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 620 (R620W)
Ref Sequence ENSEMBL: ENSMUSP00000019051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019051]
AlphaFold P55249
Predicted Effect probably damaging
Transcript: ENSMUST00000019051
AA Change: R620W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019051
Gene: ENSMUSG00000018907
AA Change: R620W

DomainStartEndE-ValueType
LH2 2 111 9.49e-38 SMART
Pfam:Lipoxygenase 163 649 1.2e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139899
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 66,964,308 (GRCm39) I184L probably benign Het
9530002B09Rik T A 4: 122,583,115 (GRCm39) probably benign Het
Abca15 A T 7: 119,960,127 (GRCm39) T637S possibly damaging Het
Adgrv1 T C 13: 81,709,588 (GRCm39) K1135R possibly damaging Het
Afap1l1 A T 18: 61,872,193 (GRCm39) probably null Het
AI467606 A G 7: 126,692,009 (GRCm39) S195G probably damaging Het
Ascc2 A T 11: 4,631,496 (GRCm39) M646L probably benign Het
Ccnt1 A T 15: 98,449,823 (GRCm39) H156Q probably benign Het
Cic T A 7: 24,972,876 (GRCm39) V869E probably damaging Het
Cpsf2 A G 12: 101,949,722 (GRCm39) D118G probably damaging Het
Csnk1g1 A G 9: 65,909,512 (GRCm39) S210G probably damaging Het
Cyp2c40 T A 19: 39,775,224 (GRCm39) M343L probably benign Het
Cyp4a12b A T 4: 115,290,700 (GRCm39) D274V possibly damaging Het
Dnaaf3 T C 7: 4,526,798 (GRCm39) I426M possibly damaging Het
Dnah3 C T 7: 119,551,132 (GRCm39) M3062I probably damaging Het
Dtx2 C T 5: 136,059,431 (GRCm39) S493F probably damaging Het
Elavl2 A T 4: 91,141,687 (GRCm39) S278R possibly damaging Het
Emilin2 T C 17: 71,581,950 (GRCm39) S259G probably benign Het
Endov T C 11: 119,390,408 (GRCm39) F12S probably damaging Het
Faim2 G A 15: 99,412,314 (GRCm39) T140I probably damaging Het
Fbxo21 T C 5: 118,115,031 (GRCm39) S56P probably benign Het
Fgb C A 3: 82,956,996 (GRCm39) D25Y probably benign Het
Foxj2 A T 6: 122,817,200 (GRCm39) H509L probably benign Het
Fth1 T A 19: 9,961,576 (GRCm39) L49Q probably damaging Het
Gbp11 C A 5: 105,476,450 (GRCm39) E220* probably null Het
Gm12695 T C 4: 96,657,963 (GRCm39) T69A probably benign Het
Gm1527 C A 3: 28,980,796 (GRCm39) T632N probably benign Het
Gm4787 A T 12: 81,425,694 (GRCm39) S155T probably benign Het
Gtf2f2 A G 14: 76,155,136 (GRCm39) S142P possibly damaging Het
Helb T C 10: 119,941,671 (GRCm39) Y339C probably benign Het
Hs3st4 A G 7: 123,996,236 (GRCm39) I301V probably benign Het
Hunk A G 16: 90,290,368 (GRCm39) D382G probably damaging Het
Ifnb1 T A 4: 88,440,996 (GRCm39) I6F possibly damaging Het
Il10 T C 1: 130,947,770 (GRCm39) L41P probably damaging Het
Il2rg A G X: 100,311,416 (GRCm39) L57P possibly damaging Het
Invs T A 4: 48,396,287 (GRCm39) L320Q probably damaging Het
Itpr3 G A 17: 27,317,050 (GRCm39) M768I probably benign Het
Krt90 T C 15: 101,466,794 (GRCm39) E263G probably benign Het
Lama2 C T 10: 27,040,922 (GRCm39) C1467Y probably damaging Het
Maco1 A T 4: 134,555,590 (GRCm39) N294K possibly damaging Het
Med24 A G 11: 98,606,472 (GRCm39) L330P probably damaging Het
Mrto4 T C 4: 139,076,334 (GRCm39) K86E probably benign Het
Mtcl1 T C 17: 66,653,350 (GRCm39) R1065G probably damaging Het
Mtmr14 G A 6: 113,217,322 (GRCm39) G38D probably damaging Het
Mtus1 T C 8: 41,535,745 (GRCm39) E657G probably damaging Het
Muc21 T A 17: 35,932,297 (GRCm39) probably benign Het
Myo5c A T 9: 75,189,150 (GRCm39) Q1020L probably benign Het
Nav1 C T 1: 135,376,742 (GRCm39) R1694Q probably damaging Het
Nckap1 T C 2: 80,400,494 (GRCm39) K69R probably damaging Het
Nlrp1b T C 11: 71,051,912 (GRCm39) N1012D probably benign Het
Ntrk2 A C 13: 59,007,111 (GRCm39) K238Q probably damaging Het
Oas1g T C 5: 121,023,946 (GRCm39) E121G probably damaging Het
Or2ab1 A G 11: 58,488,396 (GRCm39) N58S probably damaging Het
Or52n2b T C 7: 104,565,982 (GRCm39) N174D probably benign Het
Pcdh8 A T 14: 80,005,651 (GRCm39) S912R probably damaging Het
Pfpl C T 19: 12,407,237 (GRCm39) S496L probably damaging Het
Phc2 T C 4: 128,640,929 (GRCm39) F672S probably damaging Het
Pkhd1l1 A T 15: 44,414,148 (GRCm39) H2805L possibly damaging Het
Pla2g4a T C 1: 149,716,427 (GRCm39) N678S possibly damaging Het
Plxnb3 T A X: 72,815,357 (GRCm39) Y1845* probably null Het
Polr1a T G 6: 71,913,269 (GRCm39) probably null Het
Prl3d3 A C 13: 27,346,304 (GRCm39) E180D probably benign Het
Prl7a2 T A 13: 27,844,870 (GRCm39) Y172F probably damaging Het
Prpf3 A T 3: 95,751,551 (GRCm39) D383E probably benign Het
Psmc4 A T 7: 27,748,322 (GRCm39) L73H probably damaging Het
Rapgef3 C A 15: 97,664,842 (GRCm39) G7V probably damaging Het
Rasl12 G A 9: 65,318,106 (GRCm39) G157R probably damaging Het
Rnf38 A C 4: 44,149,098 (GRCm39) V83G probably damaging Het
Rnls A C 19: 33,179,944 (GRCm39) S51A probably benign Het
Siglecf A G 7: 43,001,804 (GRCm39) T205A possibly damaging Het
Skint1 T A 4: 111,882,730 (GRCm39) V258D probably benign Het
Slc12a5 C T 2: 164,839,067 (GRCm39) R1072W probably damaging Het
Spata13 GTTAGGCT GT 14: 60,998,320 (GRCm39) probably benign Het
Specc1 T G 11: 62,009,122 (GRCm39) S293A probably benign Het
Speer2 T G 16: 69,657,385 (GRCm39) Q86P probably benign Het
Tbc1d15 T C 10: 115,065,078 (GRCm39) D169G probably benign Het
Tbx20 C A 9: 24,681,067 (GRCm39) E142* probably null Het
Tcp1 T A 17: 13,139,699 (GRCm39) L199H probably damaging Het
Tex26 A T 5: 149,363,204 (GRCm39) R5W probably damaging Het
Tg C A 15: 66,700,402 (GRCm39) A120E probably damaging Het
Thrap3 T C 4: 126,069,189 (GRCm39) Y654C possibly damaging Het
Troap T C 15: 98,980,344 (GRCm39) L508P probably benign Het
Ubap2 C T 4: 41,199,872 (GRCm39) A752T probably benign Het
Ush1c T C 7: 45,878,905 (GRCm39) Y74C probably damaging Het
Vmn1r55 A G 7: 5,150,048 (GRCm39) V125A possibly damaging Het
Vmn2r120 T A 17: 57,831,553 (GRCm39) H412L possibly damaging Het
Vps54 C T 11: 21,227,955 (GRCm39) T176I probably damaging Het
Wdr95 T C 5: 149,502,627 (GRCm39) probably null Het
Zfp81 T C 17: 33,554,278 (GRCm39) T179A probably benign Het
Other mutations in Alox12e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Alox12e APN 11 70,211,880 (GRCm39) missense probably benign
IGL01781:Alox12e APN 11 70,212,282 (GRCm39) missense probably damaging 1.00
R0284:Alox12e UTSW 11 70,211,725 (GRCm39) splice site probably benign
R0417:Alox12e UTSW 11 70,212,691 (GRCm39) missense probably benign 0.12
R0557:Alox12e UTSW 11 70,212,274 (GRCm39) missense possibly damaging 0.80
R0593:Alox12e UTSW 11 70,211,723 (GRCm39) splice site probably benign
R1479:Alox12e UTSW 11 70,211,608 (GRCm39) missense probably benign 0.04
R1967:Alox12e UTSW 11 70,208,682 (GRCm39) missense probably benign 0.18
R1996:Alox12e UTSW 11 70,207,034 (GRCm39) missense probably benign 0.00
R2062:Alox12e UTSW 11 70,206,828 (GRCm39) missense probably damaging 1.00
R2067:Alox12e UTSW 11 70,206,828 (GRCm39) missense probably damaging 1.00
R2068:Alox12e UTSW 11 70,206,828 (GRCm39) missense probably damaging 1.00
R2147:Alox12e UTSW 11 70,210,771 (GRCm39) missense probably damaging 1.00
R2307:Alox12e UTSW 11 70,212,087 (GRCm39) missense probably damaging 1.00
R3034:Alox12e UTSW 11 70,207,079 (GRCm39) missense probably benign 0.01
R3739:Alox12e UTSW 11 70,210,668 (GRCm39) missense probably damaging 1.00
R4463:Alox12e UTSW 11 70,209,082 (GRCm39) missense probably damaging 1.00
R4572:Alox12e UTSW 11 70,212,007 (GRCm39) intron probably benign
R5004:Alox12e UTSW 11 70,212,330 (GRCm39) missense probably benign 0.00
R5113:Alox12e UTSW 11 70,206,821 (GRCm39) missense possibly damaging 0.70
R5155:Alox12e UTSW 11 70,207,081 (GRCm39) missense possibly damaging 0.61
R5464:Alox12e UTSW 11 70,208,505 (GRCm39) missense probably damaging 0.99
R5471:Alox12e UTSW 11 70,210,850 (GRCm39) missense probably benign 0.17
R5501:Alox12e UTSW 11 70,207,055 (GRCm39) missense probably benign 0.01
R5915:Alox12e UTSW 11 70,209,050 (GRCm39) missense possibly damaging 0.81
R6033:Alox12e UTSW 11 70,206,839 (GRCm39) missense probably benign 0.03
R6033:Alox12e UTSW 11 70,206,839 (GRCm39) missense probably benign 0.03
R6102:Alox12e UTSW 11 70,210,849 (GRCm39) missense possibly damaging 0.65
R6380:Alox12e UTSW 11 70,211,927 (GRCm39) missense probably benign 0.00
R6452:Alox12e UTSW 11 70,210,831 (GRCm39) missense probably damaging 0.96
R7175:Alox12e UTSW 11 70,210,534 (GRCm39) missense probably damaging 1.00
R7220:Alox12e UTSW 11 70,206,731 (GRCm39) missense probably benign 0.02
R7353:Alox12e UTSW 11 70,212,261 (GRCm39) missense probably damaging 1.00
R7542:Alox12e UTSW 11 70,212,582 (GRCm39) missense possibly damaging 0.69
R7916:Alox12e UTSW 11 70,212,111 (GRCm39) missense probably benign
R8314:Alox12e UTSW 11 70,206,998 (GRCm39) missense possibly damaging 0.83
R8331:Alox12e UTSW 11 70,211,923 (GRCm39) missense probably benign 0.01
R9027:Alox12e UTSW 11 70,212,600 (GRCm39) missense possibly damaging 0.68
R9380:Alox12e UTSW 11 70,206,994 (GRCm39) critical splice donor site probably null
R9641:Alox12e UTSW 11 70,212,261 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTCTATTCACCAGAGGG -3'
(R):5'- GTCATGGTGAGGCACAGATG -3'

Sequencing Primer
(F):5'- AGGACAAGACTGTGCACAC -3'
(R):5'- CAGATGCCTGGGTCCTGACTTG -3'
Posted On 2014-09-17