Incidental Mutation 'R2063:Tcp1'
ID228897
Institutional Source Beutler Lab
Gene Symbol Tcp1
Ensembl Gene ENSMUSG00000068039
Gene Namet-complex protein 1
Synonymsp63, CCT, Ccta, Cct1, c-cpn, Tp63, Tcp-1, TRic
MMRRC Submission 040068-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R2063 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location12915701-12925067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12920812 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 199 (L199H)
Ref Sequence ENSEMBL: ENSMUSP00000086418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043923] [ENSMUST00000079121] [ENSMUST00000089024] [ENSMUST00000143961] [ENSMUST00000151287] [ENSMUST00000160378]
Predicted Effect probably benign
Transcript: ENSMUST00000043923
SMART Domains Protein: ENSMUSP00000045912
Gene: ENSMUSG00000062480

DomainStartEndE-ValueType
Pfam:Thiolase_N 8 267 2.9e-97 PFAM
Pfam:Thiolase_C 274 396 1.3e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079121
SMART Domains Protein: ENSMUSP00000078123
Gene: ENSMUSG00000057388

DomainStartEndE-ValueType
PDB:4CE4|S 1 180 1e-108 PDB
SCOP:d1jj2m_ 78 141 2e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083171
Predicted Effect probably damaging
Transcript: ENSMUST00000089024
AA Change: L199H

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086418
Gene: ENSMUSG00000068039
AA Change: L199H

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 486 1.9e-132 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138709
Predicted Effect probably benign
Transcript: ENSMUST00000143961
SMART Domains Protein: ENSMUSP00000116511
Gene: ENSMUSG00000068039

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 28 103 1.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147724
Predicted Effect probably damaging
Transcript: ENSMUST00000151287
AA Change: L248H

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116108
Gene: ENSMUSG00000068039
AA Change: L248H

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 28 535 6.3e-156 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151715
Predicted Effect probably benign
Transcript: ENSMUST00000160378
SMART Domains Protein: ENSMUSP00000125454
Gene: ENSMUSG00000062480

DomainStartEndE-ValueType
Pfam:Thiolase_N 5 248 5.6e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162978
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. In addition, three pseudogenes that appear to be derived from this gene have been found. [provided by RefSeq, Jun 2010]
PHENOTYPE: There are two electrophoretic alleles known; allele a occurs in all complete t haplotype chromosomes and allele b in wild-type strains. There are multiple changes between the amino acid sequences of the TCP1A and TCP1B proteins encoded by the two alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Abca15 A T 7: 120,360,904 T637S possibly damaging Het
Adgrv1 T C 13: 81,561,469 K1135R possibly damaging Het
Afap1l1 A T 18: 61,739,122 probably null Het
AI467606 A G 7: 127,092,837 S195G probably damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Cic T A 7: 25,273,451 V869E probably damaging Het
Cpsf2 A G 12: 101,983,463 D118G probably damaging Het
Csnk1g1 A G 9: 66,002,230 S210G probably damaging Het
Cyp2c40 T A 19: 39,786,780 M343L probably benign Het
Cyp4a12b A T 4: 115,433,503 D274V possibly damaging Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah3 C T 7: 119,951,909 M3062I probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Elavl2 A T 4: 91,253,450 S278R possibly damaging Het
Emilin2 T C 17: 71,274,955 S259G probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Faim2 G A 15: 99,514,433 T140I probably damaging Het
Fbxo21 T C 5: 117,976,966 S56P probably benign Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Foxj2 A T 6: 122,840,241 H509L probably benign Het
Fth1 T A 19: 9,984,212 L49Q probably damaging Het
Gbp11 C A 5: 105,328,584 E220* probably null Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm1527 C A 3: 28,926,647 T632N probably benign Het
Gm4787 A T 12: 81,378,920 S155T probably benign Het
Gm9573 T A 17: 35,621,405 probably benign Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Helb T C 10: 120,105,766 Y339C probably benign Het
Hs3st4 A G 7: 124,397,013 I301V probably benign Het
Hunk A G 16: 90,493,480 D382G probably damaging Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il10 T C 1: 131,020,033 L41P probably damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Krt90 T C 15: 101,558,359 E263G probably benign Het
Lama2 C T 10: 27,164,926 C1467Y probably damaging Het
Med24 A G 11: 98,715,646 L330P probably damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Mtcl1 T C 17: 66,346,355 R1065G probably damaging Het
Mtmr14 G A 6: 113,240,361 G38D probably damaging Het
Mtus1 T C 8: 41,082,708 E657G probably damaging Het
Myo5c A T 9: 75,281,868 Q1020L probably benign Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nckap1 T C 2: 80,570,150 K69R probably damaging Het
Nlrp1b T C 11: 71,161,086 N1012D probably benign Het
Ntrk2 A C 13: 58,859,297 K238Q probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr667 T C 7: 104,916,775 N174D probably benign Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pfpl C T 19: 12,429,873 S496L probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pkhd1l1 A T 15: 44,550,752 H2805L possibly damaging Het
Pla2g4a T C 1: 149,840,676 N678S possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Polr1a T G 6: 71,936,285 probably null Het
Prl3d3 A C 13: 27,162,321 E180D probably benign Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Prpf3 A T 3: 95,844,239 D383E probably benign Het
Psmc4 A T 7: 28,048,897 L73H probably damaging Het
Rapgef3 C A 15: 97,766,961 G7V probably damaging Het
Rasl12 G A 9: 65,410,824 G157R probably damaging Het
Rnf38 A C 4: 44,149,098 V83G probably damaging Het
Rnls A C 19: 33,202,544 S51A probably benign Het
Siglecf A G 7: 43,352,380 T205A possibly damaging Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc12a5 C T 2: 164,997,147 R1072W probably damaging Het
Spata13 GTTAGGCT GT 14: 60,760,871 probably benign Het
Specc1 T G 11: 62,118,296 S293A probably benign Het
Speer2 T G 16: 69,860,497 Q86P probably benign Het
Tbc1d15 T C 10: 115,229,173 D169G probably benign Het
Tbx20 C A 9: 24,769,771 E142* probably null Het
Tex26 A T 5: 149,439,739 R5W probably damaging Het
Tg C A 15: 66,828,553 A120E probably damaging Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tmem57 A T 4: 134,828,279 N294K possibly damaging Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ush1c T C 7: 46,229,481 Y74C probably damaging Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Vps54 C T 11: 21,277,955 T176I probably damaging Het
Wdr95 T C 5: 149,579,162 probably null Het
Zfp81 T C 17: 33,335,304 T179A probably benign Het
Other mutations in Tcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01624:Tcp1 APN 17 12919925 missense probably benign 0.00
IGL01859:Tcp1 APN 17 12922684 missense possibly damaging 0.95
IGL02635:Tcp1 APN 17 12923409 missense probably benign 0.35
R0164:Tcp1 UTSW 17 12922747 unclassified probably benign
R0308:Tcp1 UTSW 17 12920419 missense probably benign 0.14
R0452:Tcp1 UTSW 17 12924352 missense probably benign 0.14
R0661:Tcp1 UTSW 17 12923313 missense probably benign 0.02
R0674:Tcp1 UTSW 17 12923244 missense probably damaging 1.00
R1078:Tcp1 UTSW 17 12923204 unclassified probably benign
R1434:Tcp1 UTSW 17 12922606 unclassified probably null
R1678:Tcp1 UTSW 17 12920423 missense probably benign
R1801:Tcp1 UTSW 17 12922202 nonsense probably null
R4061:Tcp1 UTSW 17 12920863 missense probably benign
R4078:Tcp1 UTSW 17 12918083 missense probably benign 0.05
R5516:Tcp1 UTSW 17 12924334 missense probably damaging 0.98
R5620:Tcp1 UTSW 17 12919337 splice site probably null
R5764:Tcp1 UTSW 17 12916602 missense probably benign 0.10
R6729:Tcp1 UTSW 17 12923253 missense probably damaging 1.00
R7112:Tcp1 UTSW 17 12917873 missense probably damaging 0.99
R7614:Tcp1 UTSW 17 12922653 missense possibly damaging 0.83
R7718:Tcp1 UTSW 17 12922162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGATCAATGGCTATGCGC -3'
(R):5'- ACCATGATGCCCATAATCCTTG -3'

Sequencing Primer
(F):5'- CAATGGCTATGCGCTCAATTG -3'
(R):5'- ATGAGTACACTGCAGCTGTC -3'
Posted On2014-09-17