Incidental Mutation 'R2063:Itpr3'
ID228898
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Nameinositol 1,4,5-triphosphate receptor 3
Synonymstf, Ip3r3, Itpr-3
MMRRC Submission 040068-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2063 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location27057304-27122223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27098076 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 768 (M768I)
Ref Sequence ENSEMBL: ENSMUSP00000038150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049308]
PDB Structure
Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000049308
AA Change: M768I

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: M768I

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143605
Meta Mutation Damage Score 0.0945 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Abca15 A T 7: 120,360,904 T637S possibly damaging Het
Adgrv1 T C 13: 81,561,469 K1135R possibly damaging Het
Afap1l1 A T 18: 61,739,122 probably null Het
AI467606 A G 7: 127,092,837 S195G probably damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Cic T A 7: 25,273,451 V869E probably damaging Het
Cpsf2 A G 12: 101,983,463 D118G probably damaging Het
Csnk1g1 A G 9: 66,002,230 S210G probably damaging Het
Cyp2c40 T A 19: 39,786,780 M343L probably benign Het
Cyp4a12b A T 4: 115,433,503 D274V possibly damaging Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah3 C T 7: 119,951,909 M3062I probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Elavl2 A T 4: 91,253,450 S278R possibly damaging Het
Emilin2 T C 17: 71,274,955 S259G probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Faim2 G A 15: 99,514,433 T140I probably damaging Het
Fbxo21 T C 5: 117,976,966 S56P probably benign Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Foxj2 A T 6: 122,840,241 H509L probably benign Het
Fth1 T A 19: 9,984,212 L49Q probably damaging Het
Gbp11 C A 5: 105,328,584 E220* probably null Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm1527 C A 3: 28,926,647 T632N probably benign Het
Gm4787 A T 12: 81,378,920 S155T probably benign Het
Gm9573 T A 17: 35,621,405 probably benign Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Helb T C 10: 120,105,766 Y339C probably benign Het
Hs3st4 A G 7: 124,397,013 I301V probably benign Het
Hunk A G 16: 90,493,480 D382G probably damaging Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il10 T C 1: 131,020,033 L41P probably damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Krt90 T C 15: 101,558,359 E263G probably benign Het
Lama2 C T 10: 27,164,926 C1467Y probably damaging Het
Med24 A G 11: 98,715,646 L330P probably damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Mtcl1 T C 17: 66,346,355 R1065G probably damaging Het
Mtmr14 G A 6: 113,240,361 G38D probably damaging Het
Mtus1 T C 8: 41,082,708 E657G probably damaging Het
Myo5c A T 9: 75,281,868 Q1020L probably benign Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nckap1 T C 2: 80,570,150 K69R probably damaging Het
Nlrp1b T C 11: 71,161,086 N1012D probably benign Het
Ntrk2 A C 13: 58,859,297 K238Q probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr667 T C 7: 104,916,775 N174D probably benign Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pfpl C T 19: 12,429,873 S496L probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pkhd1l1 A T 15: 44,550,752 H2805L possibly damaging Het
Pla2g4a T C 1: 149,840,676 N678S possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Polr1a T G 6: 71,936,285 probably null Het
Prl3d3 A C 13: 27,162,321 E180D probably benign Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Prpf3 A T 3: 95,844,239 D383E probably benign Het
Psmc4 A T 7: 28,048,897 L73H probably damaging Het
Rapgef3 C A 15: 97,766,961 G7V probably damaging Het
Rasl12 G A 9: 65,410,824 G157R probably damaging Het
Rnf38 A C 4: 44,149,098 V83G probably damaging Het
Rnls A C 19: 33,202,544 S51A probably benign Het
Siglecf A G 7: 43,352,380 T205A possibly damaging Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc12a5 C T 2: 164,997,147 R1072W probably damaging Het
Spata13 GTTAGGCT GT 14: 60,760,871 probably benign Het
Specc1 T G 11: 62,118,296 S293A probably benign Het
Speer2 T G 16: 69,860,497 Q86P probably benign Het
Tbc1d15 T C 10: 115,229,173 D169G probably benign Het
Tbx20 C A 9: 24,769,771 E142* probably null Het
Tcp1 T A 17: 12,920,812 L199H probably damaging Het
Tex26 A T 5: 149,439,739 R5W probably damaging Het
Tg C A 15: 66,828,553 A120E probably damaging Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tmem57 A T 4: 134,828,279 N294K possibly damaging Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ush1c T C 7: 46,229,481 Y74C probably damaging Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Vps54 C T 11: 21,277,955 T176I probably damaging Het
Wdr95 T C 5: 149,579,162 probably null Het
Zfp81 T C 17: 33,335,304 T179A probably benign Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27083629 missense probably benign 0.05
IGL00980:Itpr3 APN 17 27110956 missense probably benign
IGL01151:Itpr3 APN 17 27091529 missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27099765 missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27118595 missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27117178 missense probably benign 0.02
IGL01897:Itpr3 APN 17 27111262 missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27121475 missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27104095 missense probably benign
IGL02063:Itpr3 APN 17 27120023 missense probably benign 0.01
IGL02146:Itpr3 APN 17 27117275 missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27098442 missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27099614 missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27098179 missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27114512 splice site probably benign
IGL02651:Itpr3 APN 17 27106398 missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27104556 missense probably benign 0.21
IGL03001:Itpr3 APN 17 27089612 splice site probably benign
IGL03004:Itpr3 APN 17 27097978 missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27091933 missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27119266 missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27111268 missense probably benign
IGL03404:Itpr3 APN 17 27091518 missense probably damaging 1.00
alopecia UTSW 17 27095478 missense probably damaging 0.98
Beauty UTSW 17 27106342 missense probably damaging 1.00
Opuesto UTSW 17 27087592 missense probably damaging 1.00
Paradox UTSW 17 27098171 missense probably damaging 1.00
Pulchritude UTSW 17 27086960 missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27120977 missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27098322 missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0104:Itpr3 UTSW 17 27095992 missense probably benign 0.01
R0195:Itpr3 UTSW 17 27114114 missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27089319 missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27113819 missense probably benign
R0485:Itpr3 UTSW 17 27111929 missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27107289 missense probably benign 0.09
R0781:Itpr3 UTSW 17 27110555 missense probably benign 0.00
R0890:Itpr3 UTSW 17 27089011 nonsense probably null
R1028:Itpr3 UTSW 17 27091369 missense probably benign 0.04
R1144:Itpr3 UTSW 17 27114923 missense probably benign 0.01
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1458:Itpr3 UTSW 17 27118372 missense probably benign 0.01
R1463:Itpr3 UTSW 17 27117154 splice site probably benign
R1472:Itpr3 UTSW 17 27114225 missense probably benign 0.09
R1529:Itpr3 UTSW 17 27105485 splice site probably null
R1533:Itpr3 UTSW 17 27095560 missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27114147 missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27116607 critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27089013 missense probably benign
R1726:Itpr3 UTSW 17 27111690 missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27120023 missense probably benign 0.01
R1940:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27102811 missense possibly damaging 0.76
R2064:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2065:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2067:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2068:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2219:Itpr3 UTSW 17 27115053 missense probably benign
R2248:Itpr3 UTSW 17 27115059 missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27113579 missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27095915 missense probably benign
R2864:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R2865:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R3778:Itpr3 UTSW 17 27095472 missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27113840 missense probably benign 0.01
R3979:Itpr3 UTSW 17 27085131 missense probably benign 0.23
R3979:Itpr3 UTSW 17 27091572 missense probably damaging 1.00
R4224:Itpr3 UTSW 17 27107258 missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27106324 missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27111974 missense probably benign 0.00
R4466:Itpr3 UTSW 17 27106342 missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27104612 missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27093283 missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27085147 missense probably benign 0.30
R4921:Itpr3 UTSW 17 27098005 missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27083608 missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27089911 missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27098423 missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27116689 missense probably benign 0.38
R5518:Itpr3 UTSW 17 27087592 missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27107334 missense probably benign 0.09
R5566:Itpr3 UTSW 17 27115952 missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27103906 missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27113519 missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27118566 missense probably benign 0.42
R5658:Itpr3 UTSW 17 27107878 missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27106405 missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27086976 missense probably benign 0.02
R5878:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R5889:Itpr3 UTSW 17 27115065 missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27117893 missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27110921 missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27104601 missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27098171 missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27111200 missense probably benign 0.03
R6233:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27095475 missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27091370 missense probably benign
R6515:Itpr3 UTSW 17 27091370 missense probably benign
R6516:Itpr3 UTSW 17 27091370 missense probably benign
R6955:Itpr3 UTSW 17 27121467 missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27110580 missense probably benign 0.00
R7064:Itpr3 UTSW 17 27089295 missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27118561 missense probably benign 0.00
R7349:Itpr3 UTSW 17 27107812 splice site probably null
R7469:Itpr3 UTSW 17 27121054 missense possibly damaging 0.74
R7493:Itpr3 UTSW 17 27094800 missense probably benign 0.09
R7510:Itpr3 UTSW 17 27089039 missense probably damaging 0.97
R7565:Itpr3 UTSW 17 27110888 missense probably benign 0.01
R7616:Itpr3 UTSW 17 27088977 missense probably damaging 1.00
R7728:Itpr3 UTSW 17 27098114 missense probably damaging 1.00
R7779:Itpr3 UTSW 17 27096063 missense probably damaging 1.00
R7788:Itpr3 UTSW 17 27118597 nonsense probably null
R7871:Itpr3 UTSW 17 27117179 missense probably damaging 1.00
R7889:Itpr3 UTSW 17 27116777 missense probably damaging 1.00
R7954:Itpr3 UTSW 17 27117179 missense probably damaging 1.00
R7972:Itpr3 UTSW 17 27116777 missense probably damaging 1.00
R8065:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8067:Itpr3 UTSW 17 27110862 missense probably benign 0.01
V7732:Itpr3 UTSW 17 27111024 splice site probably benign
V7732:Itpr3 UTSW 17 27111026 splice site probably null
Z1088:Itpr3 UTSW 17 27113528 missense possibly damaging 0.50
Z1177:Itpr3 UTSW 17 27114929 missense probably damaging 1.00
Z1177:Itpr3 UTSW 17 27119987 missense probably damaging 1.00
Z31818:Itpr3 UTSW 17 27095478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGAAGCGTTGGTCCTCAC -3'
(R):5'- GCGTTGAGATTGGAATCATAGC -3'

Sequencing Primer
(F):5'- TCCTCACCAGGGCCATG -3'
(R):5'- AGGCATGAGGGTCCCCATG -3'
Posted On2014-09-17