Mutagenetix > Incidental Mutations

Incidental Mutation 'R0157:Plcb2'

22890

Institutional Source

Beutler Lab

Gene Symbol

Plcb2

Ensembl Gene

ENSMUSG00000040061

Gene Name

phospholipase C, beta 2

Synonyms

B230205M18Rik

MMRRC Submission

038437-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0157 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

118707517-118728438 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 118718541 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 380 (V380F)

Ref Sequence

ENSEMBL: ENSMUSP00000124364 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102524] [ENSMUST00000159756]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000006415

Predicted Effect

probably damaging
Transcript: ENSMUST00000102524
AA Change: V403F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099583
Gene: ENSMUSG00000040061
AA Change: V403F

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
Pfam:EF-hand_like	220	311	2.5e-24	PFAM
PLCXc	312	463	2.87e-79	SMART
low complexity region	504	518	N/A	INTRINSIC
PLCYc	547	663	2.39e-67	SMART
C2	684	783	9.17e-15	SMART
low complexity region	902	925	N/A	INTRINSIC
low complexity region	929	940	N/A	INTRINSIC
Pfam:PLC-beta_C	974	1149	4.7e-72	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127248

Predicted Effect

probably damaging
Transcript: ENSMUST00000159756
AA Change: V380F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124364
Gene: ENSMUSG00000040061
AA Change: V380F

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
Pfam:EF-hand_like	197	288	7.1e-26	PFAM
PLCXc	289	440	2.87e-79	SMART
low complexity region	481	495	N/A	INTRINSIC
PLCYc	524	640	2.39e-67	SMART
C2	661	760	9.17e-15	SMART
low complexity region	879	902	N/A	INTRINSIC
low complexity region	906	917	N/A	INTRINSIC
Pfam:PLC-beta_C	946	1129	5.1e-68	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 88.5%

Validation Efficiency

64% (47/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphodiesterase that catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate to the second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol. The encoded protein is activated by G proteins and has been shown to be involved in the type 2 taste receptor signal transduction pathway. In addition, nuclear factor kappa B can regulate the transcription of this gene, whose protein product is also an important regulator of platelet responses. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant mice showed an increased sensitivity to both bacterial and viral infections and exhibited abnormal taste perception in which sweet, umami, and bitter stimuli could not be sensed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adap2	T	A	11: 80,165,701	I180N	probably damaging	Het
Alk	T	A	17: 71,949,845	N673I	probably benign	Het
Ankrd7	T	C	6: 18,866,540	S20P	probably damaging	Het
Arhgef26	T	G	3: 62,380,971	D487E	probably damaging	Het
Arhgef4	A	G	1: 34,806,394	D1500G	probably damaging	Het
Arhgef7	A	G	8: 11,785,812	I39V	probably damaging	Het
Asap2	T	A	12: 21,206,325	I208N	probably damaging	Het
Atad5	T	C	11: 80,089,817	V16A	possibly damaging	Het
Atp2b1	T	C	10: 98,999,947	I518T	probably damaging	Het
B130006D01Rik	T	C	11: 95,726,385		probably benign	Het
BC028528	A	G	3: 95,884,968		probably null	Het
Bpifb6	T	A	2: 153,903,966	L74Q	probably benign	Het
Bptf	T	C	11: 107,074,658	T1122A	possibly damaging	Het
Cacna2d4	T	A	6: 119,312,424	D806E	probably benign	Het
Cdhr3	T	C	12: 33,061,650	Q287R	possibly damaging	Het
Cdk12	A	G	11: 98,249,776		probably benign	Het
Cenpf	T	A	1: 189,652,359	T2575S	probably benign	Het
Chd7	T	A	4: 8,833,759	I1171N	probably damaging	Het
Chd9	T	C	8: 91,008,836		probably null	Het
Ckmt1	A	G	2: 121,363,041	T361A	possibly damaging	Het
Clec4d	G	T	6: 123,267,136	R68L	probably benign	Het
Csmd2	G	T	4: 128,521,911	V2678F	probably benign	Het
Cul7	T	A	17: 46,653,835	V131E	possibly damaging	Het
Dab2	T	C	15: 6,429,827	S407P	probably benign	Het
Dnah17	C	T	11: 118,127,171	G166D	probably benign	Het
F13b	G	A	1: 139,503,847	V52I	probably benign	Het
Fam208b	C	A	13: 3,575,550	V1467L	probably benign	Het
Gjd4	T	C	18: 9,280,549	I176M	probably benign	Het
Gm13083	C	T	4: 143,615,796	P158S	probably damaging	Het
Gm4969	T	C	7: 19,107,020	H63R	possibly damaging	Het
Hoxc11	A	G	15: 102,955,001	Y159C	probably damaging	Het
Hydin	T	C	8: 110,300,010	I120T	possibly damaging	Het
Il20rb	A	G	9: 100,473,079	Y104H	probably damaging	Het
Krtap21-1	A	G	16: 89,403,542	C71R	unknown	Het
Lamc1	T	C	1: 153,262,607	D167G	probably benign	Het
Lin7c	C	A	2: 109,895,169	A73E	probably damaging	Het
Mms22l	C	A	4: 24,588,224	A952E	probably damaging	Het
Myh3	A	G	11: 67,082,909	N136S	probably benign	Het
Ndufb10	T	C	17: 24,724,244	T31A	probably benign	Het
Nlrp2	T	C	7: 5,308,770	Y37C	possibly damaging	Het
Olfr1384	T	C	11: 49,513,773	I45T	probably damaging	Het
Olfr314	T	C	11: 58,787,059	F275S	probably damaging	Het
Orc3	C	A	4: 34,607,130		probably null	Het
Pard3b	A	C	1: 62,211,633	M512L	probably damaging	Het
Pcdh10	A	G	3: 45,379,701	D150G	probably damaging	Het
Pcolce	A	T	5: 137,610,479		probably null	Het
Pdcl	A	C	2: 37,352,177	I187S	probably damaging	Het
Pkn1	T	C	8: 83,692,820	I51M	probably damaging	Het
Pla2g4e	T	A	2: 120,170,181	T692S	probably benign	Het
Pmpcb	A	T	5: 21,742,952	I218F	probably damaging	Het
Pms1	A	T	1: 53,195,037	Y773*	probably null	Het
Polr2e	C	T	10: 80,036,781	G184R	probably damaging	Het
Polr3a	T	C	14: 24,479,186	I369V	probably damaging	Het
Prpf4b	T	C	13: 34,884,031		probably benign	Het
Pzp	G	A	6: 128,523,976	Q140*	probably null	Het
Qrich2	T	A	11: 116,441,395	E2325V	probably damaging	Het
R3hdm2	T	G	10: 127,471,989	L373R	probably damaging	Het
Sema3d	A	T	5: 12,508,137	D212V	possibly damaging	Het
Sidt2	A	G	9: 45,939,267	I850T	probably damaging	Het
Slc22a29	C	T	19: 8,162,742	R433H	possibly damaging	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Sox21	G	A	14: 118,235,942		probably benign	Het
Steap3	A	G	1: 120,227,649	*527R	probably null	Het
Svep1	T	C	4: 58,069,830	E2652G	possibly damaging	Het
Taar2	T	A	10: 23,941,491	F310I	probably damaging	Het
Tecta	A	G	9: 42,375,011	V783A	probably benign	Het
Vmn1r173	T	A	7: 23,702,397	I19N	probably damaging	Het
Vwa5b1	T	A	4: 138,604,879	M276L	probably benign	Het
Yeats2	A	C	16: 20,221,677	*142C	probably null	Het
Zfp26	G	T	9: 20,437,870	T466K	probably benign	Het
Zfp426	T	C	9: 20,471,136	N171S	probably benign	Het

Other mutations in Plcb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Plcb2	APN	2	118718889	missense	probably damaging	1.00
IGL00715:Plcb2	APN	2	118713734	critical splice donor site	probably null
IGL00851:Plcb2	APN	2	118728251	missense	probably benign	0.30
IGL01765:Plcb2	APN	2	118710268	splice site	probably benign
IGL01837:Plcb2	APN	2	118711926	splice site	probably null
IGL01868:Plcb2	APN	2	118709590	missense	probably damaging	1.00
IGL01868:Plcb2	APN	2	118711387	missense	probably benign	0.09
IGL02158:Plcb2	APN	2	118711363	missense	probably benign	0.06
IGL02447:Plcb2	APN	2	118713155	missense	probably damaging	1.00
IGL02490:Plcb2	APN	2	118719760	missense	probably damaging	0.99
IGL02691:Plcb2	APN	2	118710963	missense	probably benign	0.00
IGL02723:Plcb2	APN	2	118717019	splice site	probably benign
IGL02929:Plcb2	APN	2	118713234	splice site	probably benign
IGL02949:Plcb2	APN	2	118719109	splice site	probably null
PIT4480001:Plcb2	UTSW	2	118723496	missense	probably benign	0.00
R0031:Plcb2	UTSW	2	118715461	missense	probably benign	0.36
R0366:Plcb2	UTSW	2	118724447	missense	probably benign	0.01
R0376:Plcb2	UTSW	2	118717240	missense	probably damaging	0.99
R0570:Plcb2	UTSW	2	118717325	missense	probably benign	0.32
R0790:Plcb2	UTSW	2	118712483	splice site	probably benign
R0893:Plcb2	UTSW	2	118725105	splice site	probably benign
R1647:Plcb2	UTSW	2	118723780	missense	possibly damaging	0.51
R1648:Plcb2	UTSW	2	118723780	missense	possibly damaging	0.51
R1686:Plcb2	UTSW	2	118715687	splice site	probably benign
R2210:Plcb2	UTSW	2	118717503	missense	probably damaging	1.00
R2211:Plcb2	UTSW	2	118723534	missense	probably benign	0.05
R2251:Plcb2	UTSW	2	118723765	missense	probably benign	0.10
R2252:Plcb2	UTSW	2	118723765	missense	probably benign	0.10
R2253:Plcb2	UTSW	2	118723765	missense	probably benign	0.10
R2426:Plcb2	UTSW	2	118715649	missense	probably damaging	1.00
R3970:Plcb2	UTSW	2	118715690	splice site	probably benign
R4007:Plcb2	UTSW	2	118710793	missense	probably damaging	1.00
R4162:Plcb2	UTSW	2	118709587	missense	probably damaging	1.00
R4236:Plcb2	UTSW	2	118709566	missense	probably damaging	1.00
R4422:Plcb2	UTSW	2	118712003	missense	probably benign	0.28
R4772:Plcb2	UTSW	2	118713134	missense	probably benign	0.20
R4795:Plcb2	UTSW	2	118711124	missense	probably benign	0.32
R4935:Plcb2	UTSW	2	118718915	missense	probably damaging	1.00
R5019:Plcb2	UTSW	2	118712136	missense	probably benign	0.01
R5055:Plcb2	UTSW	2	118718222	missense	probably benign	0.06
R5452:Plcb2	UTSW	2	118718246	missense	probably damaging	0.98
R5622:Plcb2	UTSW	2	118714729	missense	probably damaging	1.00
R5752:Plcb2	UTSW	2	118711051	intron	probably benign
R6284:Plcb2	UTSW	2	118717301	missense	probably benign	0.37
R6380:Plcb2	UTSW	2	118715468	missense	probably damaging	1.00
R6574:Plcb2	UTSW	2	118719173	missense	probably damaging	0.99
R6728:Plcb2	UTSW	2	118723690	missense	probably damaging	1.00
R6792:Plcb2	UTSW	2	118719441	missense	probably damaging	1.00
R7529:Plcb2	UTSW	2	118710234	missense	probably damaging	1.00
R7560:Plcb2	UTSW	2	118715643	missense	probably damaging	0.99
R7610:Plcb2	UTSW	2	118719759	missense	possibly damaging	0.86
R7760:Plcb2	UTSW	2	118711388	missense	probably benign
R8152:Plcb2	UTSW	2	118710821	missense	probably benign	0.22
R8170:Plcb2	UTSW	2	118711453	missense	possibly damaging	0.68
R8413:Plcb2	UTSW	2	118718823	missense	probably damaging	1.00
X0024:Plcb2	UTSW	2	118712375	missense	probably benign	0.13
Z1176:Plcb2	UTSW	2	118723128	missense	probably damaging	0.99
Z1177:Plcb2	UTSW	2	118709200	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGCAAGGTCTCTCCAAACATGCTC -3'
(R):5'- CATCTGGAATCCCTCAGGCTGTTG -3'

Sequencing Primer
(F):5'- TGGCTGCTTAGCACCAAC -3'
(R):5'- CAGGCTGTTGGGAGGCTAC -3'

Posted On

2013-04-16