Incidental Mutation 'R0157:Plcb2'
ID22890
Institutional Source Beutler Lab
Gene Symbol Plcb2
Ensembl Gene ENSMUSG00000040061
Gene Namephospholipase C, beta 2
SynonymsB230205M18Rik
MMRRC Submission 038437-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0157 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location118707517-118728438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 118718541 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 380 (V380F)
Ref Sequence ENSEMBL: ENSMUSP00000124364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102524] [ENSMUST00000159756]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000006415
Predicted Effect probably damaging
Transcript: ENSMUST00000102524
AA Change: V403F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099583
Gene: ENSMUSG00000040061
AA Change: V403F

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 220 311 2.5e-24 PFAM
PLCXc 312 463 2.87e-79 SMART
low complexity region 504 518 N/A INTRINSIC
PLCYc 547 663 2.39e-67 SMART
C2 684 783 9.17e-15 SMART
low complexity region 902 925 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
Pfam:PLC-beta_C 974 1149 4.7e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127248
Predicted Effect probably damaging
Transcript: ENSMUST00000159756
AA Change: V380F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124364
Gene: ENSMUSG00000040061
AA Change: V380F

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 197 288 7.1e-26 PFAM
PLCXc 289 440 2.87e-79 SMART
low complexity region 481 495 N/A INTRINSIC
PLCYc 524 640 2.39e-67 SMART
C2 661 760 9.17e-15 SMART
low complexity region 879 902 N/A INTRINSIC
low complexity region 906 917 N/A INTRINSIC
Pfam:PLC-beta_C 946 1129 5.1e-68 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.5%
Validation Efficiency 64% (47/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphodiesterase that catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate to the second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol. The encoded protein is activated by G proteins and has been shown to be involved in the type 2 taste receptor signal transduction pathway. In addition, nuclear factor kappa B can regulate the transcription of this gene, whose protein product is also an important regulator of platelet responses. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant mice showed an increased sensitivity to both bacterial and viral infections and exhibited abnormal taste perception in which sweet, umami, and bitter stimuli could not be sensed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap2 T A 11: 80,165,701 I180N probably damaging Het
Alk T A 17: 71,949,845 N673I probably benign Het
Ankrd7 T C 6: 18,866,540 S20P probably damaging Het
Arhgef26 T G 3: 62,380,971 D487E probably damaging Het
Arhgef4 A G 1: 34,806,394 D1500G probably damaging Het
Arhgef7 A G 8: 11,785,812 I39V probably damaging Het
Asap2 T A 12: 21,206,325 I208N probably damaging Het
Atad5 T C 11: 80,089,817 V16A possibly damaging Het
Atp2b1 T C 10: 98,999,947 I518T probably damaging Het
B130006D01Rik T C 11: 95,726,385 probably benign Het
BC028528 A G 3: 95,884,968 probably null Het
Bpifb6 T A 2: 153,903,966 L74Q probably benign Het
Bptf T C 11: 107,074,658 T1122A possibly damaging Het
Cacna2d4 T A 6: 119,312,424 D806E probably benign Het
Cdhr3 T C 12: 33,061,650 Q287R possibly damaging Het
Cdk12 A G 11: 98,249,776 probably benign Het
Cenpf T A 1: 189,652,359 T2575S probably benign Het
Chd7 T A 4: 8,833,759 I1171N probably damaging Het
Chd9 T C 8: 91,008,836 probably null Het
Ckmt1 A G 2: 121,363,041 T361A possibly damaging Het
Clec4d G T 6: 123,267,136 R68L probably benign Het
Csmd2 G T 4: 128,521,911 V2678F probably benign Het
Cul7 T A 17: 46,653,835 V131E possibly damaging Het
Dab2 T C 15: 6,429,827 S407P probably benign Het
Dnah17 C T 11: 118,127,171 G166D probably benign Het
F13b G A 1: 139,503,847 V52I probably benign Het
Fam208b C A 13: 3,575,550 V1467L probably benign Het
Gjd4 T C 18: 9,280,549 I176M probably benign Het
Gm13083 C T 4: 143,615,796 P158S probably damaging Het
Gm4969 T C 7: 19,107,020 H63R possibly damaging Het
Hoxc11 A G 15: 102,955,001 Y159C probably damaging Het
Hydin T C 8: 110,300,010 I120T possibly damaging Het
Il20rb A G 9: 100,473,079 Y104H probably damaging Het
Krtap21-1 A G 16: 89,403,542 C71R unknown Het
Lamc1 T C 1: 153,262,607 D167G probably benign Het
Lin7c C A 2: 109,895,169 A73E probably damaging Het
Mms22l C A 4: 24,588,224 A952E probably damaging Het
Myh3 A G 11: 67,082,909 N136S probably benign Het
Ndufb10 T C 17: 24,724,244 T31A probably benign Het
Nlrp2 T C 7: 5,308,770 Y37C possibly damaging Het
Olfr1384 T C 11: 49,513,773 I45T probably damaging Het
Olfr314 T C 11: 58,787,059 F275S probably damaging Het
Orc3 C A 4: 34,607,130 probably null Het
Pard3b A C 1: 62,211,633 M512L probably damaging Het
Pcdh10 A G 3: 45,379,701 D150G probably damaging Het
Pcolce A T 5: 137,610,479 probably null Het
Pdcl A C 2: 37,352,177 I187S probably damaging Het
Pkn1 T C 8: 83,692,820 I51M probably damaging Het
Pla2g4e T A 2: 120,170,181 T692S probably benign Het
Pmpcb A T 5: 21,742,952 I218F probably damaging Het
Pms1 A T 1: 53,195,037 Y773* probably null Het
Polr2e C T 10: 80,036,781 G184R probably damaging Het
Polr3a T C 14: 24,479,186 I369V probably damaging Het
Prpf4b T C 13: 34,884,031 probably benign Het
Pzp G A 6: 128,523,976 Q140* probably null Het
Qrich2 T A 11: 116,441,395 E2325V probably damaging Het
R3hdm2 T G 10: 127,471,989 L373R probably damaging Het
Sema3d A T 5: 12,508,137 D212V possibly damaging Het
Sidt2 A G 9: 45,939,267 I850T probably damaging Het
Slc22a29 C T 19: 8,162,742 R433H possibly damaging Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sox21 G A 14: 118,235,942 probably benign Het
Steap3 A G 1: 120,227,649 *527R probably null Het
Svep1 T C 4: 58,069,830 E2652G possibly damaging Het
Taar2 T A 10: 23,941,491 F310I probably damaging Het
Tecta A G 9: 42,375,011 V783A probably benign Het
Vmn1r173 T A 7: 23,702,397 I19N probably damaging Het
Vwa5b1 T A 4: 138,604,879 M276L probably benign Het
Yeats2 A C 16: 20,221,677 *142C probably null Het
Zfp26 G T 9: 20,437,870 T466K probably benign Het
Zfp426 T C 9: 20,471,136 N171S probably benign Het
Other mutations in Plcb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Plcb2 APN 2 118718889 missense probably damaging 1.00
IGL00715:Plcb2 APN 2 118713734 critical splice donor site probably null
IGL00851:Plcb2 APN 2 118728251 missense probably benign 0.30
IGL01765:Plcb2 APN 2 118710268 splice site probably benign
IGL01837:Plcb2 APN 2 118711926 splice site probably null
IGL01868:Plcb2 APN 2 118709590 missense probably damaging 1.00
IGL01868:Plcb2 APN 2 118711387 missense probably benign 0.09
IGL02158:Plcb2 APN 2 118711363 missense probably benign 0.06
IGL02447:Plcb2 APN 2 118713155 missense probably damaging 1.00
IGL02490:Plcb2 APN 2 118719760 missense probably damaging 0.99
IGL02691:Plcb2 APN 2 118710963 missense probably benign 0.00
IGL02723:Plcb2 APN 2 118717019 splice site probably benign
IGL02929:Plcb2 APN 2 118713234 splice site probably benign
IGL02949:Plcb2 APN 2 118719109 splice site probably null
PIT4480001:Plcb2 UTSW 2 118723496 missense probably benign 0.00
R0031:Plcb2 UTSW 2 118715461 missense probably benign 0.36
R0366:Plcb2 UTSW 2 118724447 missense probably benign 0.01
R0376:Plcb2 UTSW 2 118717240 missense probably damaging 0.99
R0570:Plcb2 UTSW 2 118717325 missense probably benign 0.32
R0790:Plcb2 UTSW 2 118712483 splice site probably benign
R0893:Plcb2 UTSW 2 118725105 splice site probably benign
R1647:Plcb2 UTSW 2 118723780 missense possibly damaging 0.51
R1648:Plcb2 UTSW 2 118723780 missense possibly damaging 0.51
R1686:Plcb2 UTSW 2 118715687 splice site probably benign
R2210:Plcb2 UTSW 2 118717503 missense probably damaging 1.00
R2211:Plcb2 UTSW 2 118723534 missense probably benign 0.05
R2251:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2252:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2253:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2426:Plcb2 UTSW 2 118715649 missense probably damaging 1.00
R3970:Plcb2 UTSW 2 118715690 splice site probably benign
R4007:Plcb2 UTSW 2 118710793 missense probably damaging 1.00
R4162:Plcb2 UTSW 2 118709587 missense probably damaging 1.00
R4236:Plcb2 UTSW 2 118709566 missense probably damaging 1.00
R4422:Plcb2 UTSW 2 118712003 missense probably benign 0.28
R4772:Plcb2 UTSW 2 118713134 missense probably benign 0.20
R4795:Plcb2 UTSW 2 118711124 missense probably benign 0.32
R4935:Plcb2 UTSW 2 118718915 missense probably damaging 1.00
R5019:Plcb2 UTSW 2 118712136 missense probably benign 0.01
R5055:Plcb2 UTSW 2 118718222 missense probably benign 0.06
R5452:Plcb2 UTSW 2 118718246 missense probably damaging 0.98
R5622:Plcb2 UTSW 2 118714729 missense probably damaging 1.00
R5752:Plcb2 UTSW 2 118711051 intron probably benign
R6284:Plcb2 UTSW 2 118717301 missense probably benign 0.37
R6380:Plcb2 UTSW 2 118715468 missense probably damaging 1.00
R6574:Plcb2 UTSW 2 118719173 missense probably damaging 0.99
R6728:Plcb2 UTSW 2 118723690 missense probably damaging 1.00
R6792:Plcb2 UTSW 2 118719441 missense probably damaging 1.00
R7529:Plcb2 UTSW 2 118710234 missense probably damaging 1.00
R7560:Plcb2 UTSW 2 118715643 missense probably damaging 0.99
R7610:Plcb2 UTSW 2 118719759 missense possibly damaging 0.86
R7760:Plcb2 UTSW 2 118711388 missense probably benign
X0024:Plcb2 UTSW 2 118712375 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGCAAGGTCTCTCCAAACATGCTC -3'
(R):5'- CATCTGGAATCCCTCAGGCTGTTG -3'

Sequencing Primer
(F):5'- TGGCTGCTTAGCACCAAC -3'
(R):5'- CAGGCTGTTGGGAGGCTAC -3'
Posted On2013-04-16