Incidental Mutation 'R2064:Cdc123'
ID 228921
Institutional Source Beutler Lab
Gene Symbol Cdc123
Ensembl Gene ENSMUSG00000039128
Gene Name cell division cycle 123
Synonyms G431001I09Rik
MMRRC Submission 040069-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2064 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 5799105-5849975 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 5800354 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043864]
AlphaFold Q8CII2
Predicted Effect probably benign
Transcript: ENSMUST00000043864
SMART Domains Protein: ENSMUSP00000043033
Gene: ENSMUSG00000039128

DomainStartEndE-ValueType
Pfam:D123 14 314 3e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130142
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 99% (114/115)
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 66,964,308 (GRCm39) I184L probably benign Het
9530002B09Rik T A 4: 122,583,115 (GRCm39) probably benign Het
Actr1b A G 1: 36,741,168 (GRCm39) F138L possibly damaging Het
Adamts14 G T 10: 61,041,301 (GRCm39) P803Q probably benign Het
Afap1l1 A T 18: 61,872,193 (GRCm39) probably null Het
Akt3 A G 1: 176,930,551 (GRCm39) S136P possibly damaging Het
Aldh16a1 C T 7: 44,796,585 (GRCm39) probably null Het
Alg12 A G 15: 88,696,318 (GRCm39) W238R probably damaging Het
Amy2a1 T C 3: 113,324,217 (GRCm39) I108V probably benign Het
Arhgap23 T A 11: 97,383,888 (GRCm39) C1144S probably benign Het
Arhgef40 G A 14: 52,233,640 (GRCm39) V829M probably damaging Het
Atg7 C A 6: 114,680,324 (GRCm39) N344K probably damaging Het
Aunip T A 4: 134,250,618 (GRCm39) S188T probably benign Het
Bmpr1b A T 3: 141,576,568 (GRCm39) H88Q probably benign Het
Brpf3 G A 17: 29,040,338 (GRCm39) G920S probably benign Het
Cdhr1 T C 14: 36,817,062 (GRCm39) R100G probably benign Het
Cdkn2d A G 9: 21,202,175 (GRCm39) V24A probably damaging Het
Cirbp T C 10: 80,006,166 (GRCm39) probably benign Het
Clptm1l C T 13: 73,755,842 (GRCm39) Q153* probably null Het
Col12a1 A G 9: 79,569,736 (GRCm39) probably benign Het
Cplane1 T A 15: 8,215,649 (GRCm39) S402T probably damaging Het
Cpox T A 16: 58,494,772 (GRCm39) C270S probably benign Het
Cspg4 A G 9: 56,803,940 (GRCm39) D1677G probably damaging Het
Cyp4a10 T A 4: 115,381,917 (GRCm39) probably benign Het
Dctn4 T C 18: 60,671,349 (GRCm39) F74L possibly damaging Het
Dennd5a G A 7: 109,497,900 (GRCm39) probably benign Het
Dnaaf3 T C 7: 4,526,798 (GRCm39) I426M possibly damaging Het
Dnah9 C T 11: 66,036,261 (GRCm39) S185N probably benign Het
Dqx1 T G 6: 83,035,524 (GRCm39) probably benign Het
Dtx2 C T 5: 136,059,431 (GRCm39) S493F probably damaging Het
Ehd1 T C 19: 6,348,108 (GRCm39) L362P probably benign Het
Endov T C 11: 119,390,408 (GRCm39) F12S probably damaging Het
Ep400 A C 5: 110,883,270 (GRCm39) probably benign Het
Epha1 G T 6: 42,342,987 (GRCm39) H187Q probably benign Het
Exoc2 T C 13: 31,119,544 (GRCm39) D119G probably benign Het
Fbn2 C T 18: 58,181,921 (GRCm39) E1827K probably damaging Het
Fbxo41 C T 6: 85,455,453 (GRCm39) W577* probably null Het
Fgd6 G A 10: 93,880,903 (GRCm39) A586T probably damaging Het
Gm12695 T C 4: 96,657,963 (GRCm39) T69A probably benign Het
Gm12888 A T 4: 121,182,069 (GRCm39) W8R unknown Het
Gm2959 A G 14: 42,235,658 (GRCm39) noncoding transcript Het
Gm6214 A G 3: 140,544,978 (GRCm39) noncoding transcript Het
Gm9912 T C 3: 148,890,795 (GRCm39) T113A unknown Het
Gmeb2 A G 2: 180,895,763 (GRCm39) L469P probably benign Het
Gosr1 T C 11: 76,628,224 (GRCm39) I177V probably benign Het
Gria1 T C 11: 57,208,534 (GRCm39) F810L probably damaging Het
Gtf2ird2 C T 5: 134,245,340 (GRCm39) Q533* probably null Het
Hadhb T A 5: 30,378,796 (GRCm39) probably null Het
Hat1 A T 2: 71,240,504 (GRCm39) Y66F possibly damaging Het
Hk1 T C 10: 62,122,315 (GRCm39) Y488C probably benign Het
Htt C T 5: 34,983,326 (GRCm39) T975I probably benign Het
Ifnb1 T A 4: 88,440,996 (GRCm39) I6F possibly damaging Het
Il19 T C 1: 130,866,854 (GRCm39) H42R probably benign Het
Il2rg A G X: 100,311,416 (GRCm39) L57P possibly damaging Het
Impg2 G A 16: 56,063,993 (GRCm39) probably null Het
Invs T A 4: 48,396,287 (GRCm39) L320Q probably damaging Het
Itga9 T C 9: 118,636,361 (GRCm39) F683S probably damaging Het
Itih2 A G 2: 10,135,385 (GRCm39) S2P possibly damaging Het
Itpr3 G A 17: 27,317,050 (GRCm39) M768I probably benign Het
Kcnab1 A G 3: 65,272,060 (GRCm39) E315G probably benign Het
Kcnmb2 A C 3: 32,252,437 (GRCm39) I213L probably damaging Het
Khdc1a T A 1: 21,421,196 (GRCm39) M127K probably benign Het
Klhl28 T C 12: 64,990,246 (GRCm39) N565S probably benign Het
Lcp1 A G 14: 75,435,515 (GRCm39) probably null Het
Mcm4 T C 16: 15,452,333 (GRCm39) T267A possibly damaging Het
Mlxipl A T 5: 135,161,631 (GRCm39) T517S possibly damaging Het
Mpp3 T A 11: 101,891,516 (GRCm39) I541L probably benign Het
Mpp4 G A 1: 59,182,941 (GRCm39) P322L possibly damaging Het
Myh15 G A 16: 48,975,984 (GRCm39) A1351T possibly damaging Het
Nacc1 A T 8: 85,399,747 (GRCm39) M490K probably benign Het
Nbeal1 C A 1: 60,309,515 (GRCm39) Q496K possibly damaging Het
Oas1g T C 5: 121,023,946 (GRCm39) E121G probably damaging Het
Or14j1 T A 17: 38,145,893 (GRCm39) M1K probably null Het
Pard3 T C 8: 128,337,092 (GRCm39) L1236P probably damaging Het
Phc2 T C 4: 128,640,929 (GRCm39) F672S probably damaging Het
Phf21a C A 2: 92,157,422 (GRCm39) N183K possibly damaging Het
Plxnb3 T A X: 72,815,357 (GRCm39) Y1845* probably null Het
Prl3c1 G A 13: 27,380,720 (GRCm39) probably null Het
Prl7a2 T A 13: 27,844,870 (GRCm39) Y172F probably damaging Het
Psg16 T G 7: 16,827,673 (GRCm39) S210A possibly damaging Het
Psg25 T A 7: 18,255,178 (GRCm39) K446M probably damaging Het
Ptprz1 A G 6: 23,050,388 (GRCm39) probably benign Het
Rgs7 A T 1: 174,949,508 (GRCm39) F160L probably damaging Het
Rpl22l1 A T 3: 28,860,957 (GRCm39) E57D possibly damaging Het
Rpl35 A G 2: 38,894,753 (GRCm39) L44P possibly damaging Het
Rtn4r T C 16: 17,969,121 (GRCm39) L183P probably damaging Het
Skint1 T A 4: 111,882,730 (GRCm39) V258D probably benign Het
Slc4a7 G A 14: 14,733,773 (GRCm38) R67H probably damaging Het
Smg1 C T 7: 117,756,090 (GRCm39) probably benign Het
Smurf2 T C 11: 106,762,374 (GRCm39) T39A probably damaging Het
Sspo A T 6: 48,450,596 (GRCm39) D2595V probably damaging Het
Tatdn2 A G 6: 113,681,103 (GRCm39) K379E probably benign Het
Tbc1d14 G A 5: 36,680,274 (GRCm39) R68* probably null Het
Tgm1 A G 14: 55,946,928 (GRCm39) I360T probably damaging Het
Thrap3 T C 4: 126,069,189 (GRCm39) Y654C possibly damaging Het
Traf1 A T 2: 34,838,202 (GRCm39) I212N probably benign Het
Ttc17 C A 2: 94,196,892 (GRCm39) W485L probably damaging Het
Ttn C A 2: 76,768,675 (GRCm39) V2920F probably damaging Het
Tyr T C 7: 87,142,051 (GRCm39) I93V probably benign Het
Ubap2 C T 4: 41,199,872 (GRCm39) A752T probably benign Het
Vmn1r212 A G 13: 23,068,285 (GRCm39) V16A probably benign Het
Vmn1r55 A G 7: 5,150,048 (GRCm39) V125A possibly damaging Het
Vmn2r120 T A 17: 57,831,553 (GRCm39) H412L possibly damaging Het
Xirp1 T C 9: 119,845,962 (GRCm39) I974V probably benign Het
Zap70 A G 1: 36,818,215 (GRCm39) T301A probably benign Het
Zfhx4 A G 3: 5,463,987 (GRCm39) K1382E probably damaging Het
Zfp280b T A 10: 75,875,017 (GRCm39) C299S probably damaging Het
Zfp352 C T 4: 90,113,357 (GRCm39) S499L probably benign Het
Zfp423 G A 8: 88,507,986 (GRCm39) A661V probably benign Het
Zfp57 T A 17: 37,320,568 (GRCm39) F141I possibly damaging Het
Zfp946 A T 17: 22,674,446 (GRCm39) H400L probably damaging Het
Zgrf1 T C 3: 127,406,999 (GRCm39) C1589R probably damaging Het
Other mutations in Cdc123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Cdc123 APN 2 5,809,746 (GRCm39) missense probably benign 0.01
IGL00422:Cdc123 APN 2 5,803,260 (GRCm39) missense probably benign 0.07
IGL01860:Cdc123 APN 2 5,808,752 (GRCm39) splice site probably benign
IGL03002:Cdc123 APN 2 5,803,166 (GRCm39) splice site probably benign
Sinking UTSW 2 5,803,174 (GRCm39) missense possibly damaging 0.82
R0563:Cdc123 UTSW 2 5,803,212 (GRCm39) missense probably benign
R1412:Cdc123 UTSW 2 5,808,776 (GRCm39) missense possibly damaging 0.80
R1584:Cdc123 UTSW 2 5,808,788 (GRCm39) critical splice acceptor site probably null
R1838:Cdc123 UTSW 2 5,799,702 (GRCm39) splice site probably null
R2144:Cdc123 UTSW 2 5,815,617 (GRCm39) missense probably benign 0.19
R4082:Cdc123 UTSW 2 5,815,566 (GRCm39) intron probably benign
R4679:Cdc123 UTSW 2 5,849,703 (GRCm39) missense probably damaging 1.00
R4970:Cdc123 UTSW 2 5,809,748 (GRCm39) missense possibly damaging 0.59
R5089:Cdc123 UTSW 2 5,809,811 (GRCm39) missense probably benign 0.00
R5112:Cdc123 UTSW 2 5,809,748 (GRCm39) missense possibly damaging 0.59
R5691:Cdc123 UTSW 2 5,827,986 (GRCm39) missense probably benign 0.00
R5914:Cdc123 UTSW 2 5,803,174 (GRCm39) missense possibly damaging 0.82
R7860:Cdc123 UTSW 2 5,808,775 (GRCm39) missense probably benign 0.00
R8695:Cdc123 UTSW 2 5,826,174 (GRCm39) missense possibly damaging 0.69
R8865:Cdc123 UTSW 2 5,800,235 (GRCm39) intron probably benign
R9018:Cdc123 UTSW 2 5,849,683 (GRCm39) missense probably benign 0.00
R9265:Cdc123 UTSW 2 5,808,765 (GRCm39) missense possibly damaging 0.50
Z1176:Cdc123 UTSW 2 5,809,796 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATCTTCGAGCCCCTGACAAC -3'
(R):5'- GCATTGGAATTGTACTGCTGTCATTC -3'

Sequencing Primer
(F):5'- CATACTTCAAAGCTAGCAGAATGAAG -3'
(R):5'- ACTGCTGTCATTCTTTTAGTTTGG -3'
Posted On 2014-09-17