Incidental Mutation 'R2064:Pard3'
ID228980
Institutional Source Beutler Lab
Gene Symbol Pard3
Ensembl Gene ENSMUSG00000025812
Gene Namepar-3 family cell polarity regulator
SynonymsASIP, PAR-3, Pard3a, Par3, D8Ertd580e
MMRRC Submission 040069-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2064 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location127063893-127612286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127610611 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1236 (L1236P)
Ref Sequence ENSEMBL: ENSMUSP00000125212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026921] [ENSMUST00000160272] [ENSMUST00000160766] [ENSMUST00000162309] [ENSMUST00000162536]
Predicted Effect probably damaging
Transcript: ENSMUST00000026921
AA Change: L1266P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026921
Gene: ENSMUSG00000025812
AA Change: L1266P

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1.1e-72 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 3e-10 PDB
low complexity region 863 875 N/A INTRINSIC
low complexity region 892 902 N/A INTRINSIC
low complexity region 921 950 N/A INTRINSIC
low complexity region 965 1005 N/A INTRINSIC
low complexity region 1162 1200 N/A INTRINSIC
low complexity region 1264 1281 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159940
Predicted Effect probably damaging
Transcript: ENSMUST00000160272
AA Change: L1281P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125453
Gene: ENSMUSG00000025812
AA Change: L1281P

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1.7e-60 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 4e-10 PDB
low complexity region 878 890 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 936 965 N/A INTRINSIC
low complexity region 980 1020 N/A INTRINSIC
low complexity region 1177 1215 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160766
AA Change: L1194P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124533
Gene: ENSMUSG00000025812
AA Change: L1194P

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1e-72 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 542 627 9.87e-14 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
low complexity region 820 830 N/A INTRINSIC
low complexity region 849 878 N/A INTRINSIC
low complexity region 893 933 N/A INTRINSIC
low complexity region 1090 1128 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162309
AA Change: L1280P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124282
Gene: ENSMUSG00000025812
AA Change: L1280P

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 6.2e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 4e-10 PDB
low complexity region 877 889 N/A INTRINSIC
low complexity region 906 916 N/A INTRINSIC
low complexity region 935 964 N/A INTRINSIC
low complexity region 979 1019 N/A INTRINSIC
low complexity region 1176 1214 N/A INTRINSIC
low complexity region 1278 1295 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162536
AA Change: L1236P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125212
Gene: ENSMUSG00000025812
AA Change: L1236P

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1e-72 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 555 640 9.87e-14 SMART
low complexity region 727 737 N/A INTRINSIC
PDB:4DC2|Z 766 793 3e-10 PDB
low complexity region 833 845 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
low complexity region 891 920 N/A INTRINSIC
low complexity region 935 975 N/A INTRINSIC
low complexity region 1132 1170 N/A INTRINSIC
low complexity region 1234 1251 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162665
AA Change: L1270P
SMART Domains Protein: ENSMUSP00000124718
Gene: ENSMUSG00000025812
AA Change: L1270P

DomainStartEndE-ValueType
Pfam:DUF3534 21 166 1.4e-60 PFAM
low complexity region 254 266 N/A INTRINSIC
PDZ 302 381 2.34e-6 SMART
low complexity region 451 460 N/A INTRINSIC
PDZ 489 568 4.1e-20 SMART
PDZ 619 704 9.87e-14 SMART
low complexity region 791 801 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 897 907 N/A INTRINSIC
low complexity region 926 955 N/A INTRINSIC
low complexity region 970 1010 N/A INTRINSIC
low complexity region 1167 1205 N/A INTRINSIC
low complexity region 1269 1286 N/A INTRINSIC
Meta Mutation Damage Score 0.292 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 99% (114/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PARD protein family. PARD family members interact with other PARD family members and other proteins; they affect asymmetrical cell division and direct polarized cell growth. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E12.5 associated with growth retardation, abnormal heart development, and abnormal epicardial cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,186,165 S402T probably damaging Het
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Actr1b A G 1: 36,702,087 F138L possibly damaging Het
Adamts14 G T 10: 61,205,522 P803Q probably benign Het
Afap1l1 A T 18: 61,739,122 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Aldh16a1 C T 7: 45,147,161 probably null Het
Alg12 A G 15: 88,812,115 W238R probably damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Arhgap23 T A 11: 97,493,062 C1144S probably benign Het
Arhgef40 G A 14: 51,996,183 V829M probably damaging Het
Atg7 C A 6: 114,703,363 N344K probably damaging Het
Aunip T A 4: 134,523,307 S188T probably benign Het
Bmpr1b A T 3: 141,870,807 H88Q probably benign Het
Brpf3 G A 17: 28,821,364 G920S probably benign Het
Cdc123 C T 2: 5,795,543 probably benign Het
Cdhr1 T C 14: 37,095,105 R100G probably benign Het
Cdkn2d A G 9: 21,290,879 V24A probably damaging Het
Cirbp T C 10: 80,170,332 probably benign Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Col12a1 A G 9: 79,662,454 probably benign Het
Cpox T A 16: 58,674,409 C270S probably benign Het
Cspg4 A G 9: 56,896,656 D1677G probably damaging Het
Cyp4a10 T A 4: 115,524,720 probably benign Het
Dctn4 T C 18: 60,538,277 F74L possibly damaging Het
Dennd5a G A 7: 109,898,693 probably benign Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah9 C T 11: 66,145,435 S185N probably benign Het
Dqx1 T G 6: 83,058,543 probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Ep400 A C 5: 110,735,404 probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Exoc2 T C 13: 30,935,561 D119G probably benign Het
Fbn2 C T 18: 58,048,849 E1827K probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fgd6 G A 10: 94,045,041 A586T probably damaging Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm12888 A T 4: 121,324,872 W8R unknown Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm6214 A G 3: 140,839,217 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gmeb2 A G 2: 181,253,970 L469P probably benign Het
Gosr1 T C 11: 76,737,398 I177V probably benign Het
Gria1 T C 11: 57,317,708 F810L probably damaging Het
Gtf2ird2 C T 5: 134,216,498 Q533* probably null Het
Hadhb T A 5: 30,173,798 probably null Het
Hat1 A T 2: 71,410,160 Y66F possibly damaging Het
Hk1 T C 10: 62,286,536 Y488C probably benign Het
Htt C T 5: 34,825,982 T975I probably benign Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il19 T C 1: 130,939,117 H42R probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Impg2 G A 16: 56,243,630 probably null Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Itga9 T C 9: 118,807,293 F683S probably damaging Het
Itih2 A G 2: 10,130,574 S2P possibly damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Kcnab1 A G 3: 65,364,639 E315G probably benign Het
Kcnmb2 A C 3: 32,198,288 I213L probably damaging Het
Khdc1a T A 1: 21,350,972 M127K probably benign Het
Klhl28 T C 12: 64,943,472 N565S probably benign Het
Lcp1 A G 14: 75,198,075 probably null Het
Mcm4 T C 16: 15,634,469 T267A possibly damaging Het
Mlxipl A T 5: 135,132,777 T517S possibly damaging Het
Mpp3 T A 11: 102,000,690 I541L probably benign Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Myh15 G A 16: 49,155,621 A1351T possibly damaging Het
Nacc1 A T 8: 84,673,118 M490K probably benign Het
Nbeal1 C A 1: 60,270,356 Q496K possibly damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr125 T A 17: 37,835,002 M1K probably null Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Phf21a C A 2: 92,327,077 N183K possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Prl3c1 G A 13: 27,196,737 probably null Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Psg16 T G 7: 17,093,748 S210A possibly damaging Het
Psg25 T A 7: 18,521,253 K446M probably damaging Het
Ptprz1 A G 6: 23,050,389 probably benign Het
Rgs7 A T 1: 175,121,942 F160L probably damaging Het
Rpl22l1 A T 3: 28,806,808 E57D possibly damaging Het
Rpl35 A G 2: 39,004,741 L44P possibly damaging Het
Rtn4r T C 16: 18,151,257 L183P probably damaging Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc4a7 G A 14: 14,733,773 R67H probably damaging Het
Smg1 C T 7: 118,156,867 probably benign Het
Smurf2 T C 11: 106,871,548 T39A probably damaging Het
Sspo A T 6: 48,473,662 D2595V probably damaging Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Tbc1d14 G A 5: 36,522,930 R68* probably null Het
Tgm1 A G 14: 55,709,471 I360T probably damaging Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Traf1 A T 2: 34,948,190 I212N probably benign Het
Ttc17 C A 2: 94,366,547 W485L probably damaging Het
Ttn C A 2: 76,938,331 V2920F probably damaging Het
Tyr T C 7: 87,492,843 I93V probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Vmn1r212 A G 13: 22,884,115 V16A probably benign Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Xirp1 T C 9: 120,016,896 I974V probably benign Het
Zap70 A G 1: 36,779,134 T301A probably benign Het
Zfhx4 A G 3: 5,398,927 K1382E probably damaging Het
Zfp280b T A 10: 76,039,183 C299S probably damaging Het
Zfp352 C T 4: 90,225,120 S499L probably benign Het
Zfp423 G A 8: 87,781,358 A661V probably benign Het
Zfp57 T A 17: 37,009,676 F141I possibly damaging Het
Zfp946 A T 17: 22,455,465 H400L probably damaging Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Pard3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Pard3 APN 8 127359818 splice site probably benign
IGL00484:Pard3 APN 8 127371846 missense probably benign 0.05
IGL00674:Pard3 APN 8 127388678 missense probably damaging 1.00
IGL01471:Pard3 APN 8 127378246 missense probably benign 0.01
IGL01505:Pard3 APN 8 127324063 missense probably damaging 1.00
IGL02252:Pard3 APN 8 127398756 missense probably benign 0.09
IGL02511:Pard3 APN 8 127161320 splice site probably benign
IGL02838:Pard3 APN 8 127426647 missense probably damaging 0.99
IGL02948:Pard3 APN 8 127306494 missense probably benign 0.00
IGL02987:Pard3 APN 8 127389491 missense probably damaging 0.98
IGL03037:Pard3 APN 8 127306494 missense probably benign 0.00
IGL03084:Pard3 APN 8 127593092 missense probably damaging 0.96
R0025:Pard3 UTSW 8 127161308 missense probably damaging 1.00
R0025:Pard3 UTSW 8 127161308 missense probably damaging 1.00
R0029:Pard3 UTSW 8 127426758 splice site probably benign
R0109:Pard3 UTSW 8 127398666 missense probably damaging 1.00
R0309:Pard3 UTSW 8 127376897 splice site probably benign
R0415:Pard3 UTSW 8 127610566 missense probably damaging 1.00
R0507:Pard3 UTSW 8 127371486 splice site probably benign
R1055:Pard3 UTSW 8 127378280 missense probably benign 0.34
R1305:Pard3 UTSW 8 127306410 missense possibly damaging 0.62
R1619:Pard3 UTSW 8 127380502 missense probably benign 0.02
R1855:Pard3 UTSW 8 127447812 splice site probably null
R2001:Pard3 UTSW 8 127064347 utr 5 prime probably null
R2060:Pard3 UTSW 8 127398604 missense probably benign 0.05
R2113:Pard3 UTSW 8 127388537 missense probably damaging 1.00
R2136:Pard3 UTSW 8 127376885 critical splice donor site probably null
R2224:Pard3 UTSW 8 127359776 missense probably damaging 1.00
R2252:Pard3 UTSW 8 127610599 missense probably damaging 1.00
R3870:Pard3 UTSW 8 127409686 missense probably damaging 1.00
R4154:Pard3 UTSW 8 127474396 missense probably damaging 1.00
R4212:Pard3 UTSW 8 127610458 missense probably benign 0.43
R4243:Pard3 UTSW 8 127371647 missense probably benign 0.09
R4523:Pard3 UTSW 8 127398627 missense probably benign 0.08
R4857:Pard3 UTSW 8 127324054 missense probably damaging 0.98
R4876:Pard3 UTSW 8 127561469 intron probably benign
R4877:Pard3 UTSW 8 127388537 missense probably damaging 1.00
R5197:Pard3 UTSW 8 127073290 splice site probably null
R5215:Pard3 UTSW 8 127378264 missense probably damaging 1.00
R5279:Pard3 UTSW 8 127460386 critical splice donor site probably null
R5349:Pard3 UTSW 8 127415743 missense probably damaging 1.00
R5479:Pard3 UTSW 8 127370355 missense probably damaging 1.00
R5514:Pard3 UTSW 8 127426605 missense probably damaging 1.00
R5681:Pard3 UTSW 8 127389433 missense possibly damaging 0.81
R5934:Pard3 UTSW 8 127389338 missense probably damaging 1.00
R6034:Pard3 UTSW 8 127064327 utr 5 prime probably benign
R6034:Pard3 UTSW 8 127064327 utr 5 prime probably benign
R6187:Pard3 UTSW 8 127073273 missense probably benign 0.00
R6382:Pard3 UTSW 8 127376783 missense probably damaging 1.00
R6774:Pard3 UTSW 8 127410747 missense probably damaging 0.98
R7130:Pard3 UTSW 8 127415683 missense probably damaging 1.00
R7267:Pard3 UTSW 8 127371575 missense probably damaging 0.97
R7358:Pard3 UTSW 8 127593092 missense probably damaging 0.98
R7528:Pard3 UTSW 8 127603165 missense probably damaging 1.00
R7537:Pard3 UTSW 8 127610582 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGAAGAATGCCAGCTC -3'
(R):5'- GCACAAGTCTTCATGGGTAAATGTC -3'

Sequencing Primer
(F):5'- TGCCAGCTCCATATCACAGGATTC -3'
(R):5'- AAAATGCTGCCATCCTTCTTTGAG -3'
Posted On2014-09-17