Incidental Mutation 'R2064:Clptm1l'
ID 229005
Institutional Source Beutler Lab
Gene Symbol Clptm1l
Ensembl Gene ENSMUSG00000021610
Gene Name CLPTM1-like
Synonyms C130052I12Rik
MMRRC Submission 040069-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2064 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 73604006-73620605 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 73607723 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 153 (Q153*)
Ref Sequence ENSEMBL: ENSMUSP00000022102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022102]
AlphaFold Q8BXA5
Predicted Effect probably null
Transcript: ENSMUST00000022102
AA Change: Q153*
SMART Domains Protein: ENSMUSP00000022102
Gene: ENSMUSG00000021610
AA Change: Q153*

DomainStartEndE-ValueType
Pfam:CLPTM1 10 423 3.2e-134 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221417
Meta Mutation Damage Score 0.9704 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 99% (114/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein whose overexpression in cisplatin-sensitive cells causes apoptosis. Polymorphisms in this gene have been reported to increase susceptibility to several cancers, including lung, pancreatic, and breast cancers. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,186,165 S402T probably damaging Het
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Actr1b A G 1: 36,702,087 F138L possibly damaging Het
Adamts14 G T 10: 61,205,522 P803Q probably benign Het
Afap1l1 A T 18: 61,739,122 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Aldh16a1 C T 7: 45,147,161 probably null Het
Alg12 A G 15: 88,812,115 W238R probably damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Arhgap23 T A 11: 97,493,062 C1144S probably benign Het
Arhgef40 G A 14: 51,996,183 V829M probably damaging Het
Atg7 C A 6: 114,703,363 N344K probably damaging Het
Aunip T A 4: 134,523,307 S188T probably benign Het
Bmpr1b A T 3: 141,870,807 H88Q probably benign Het
Brpf3 G A 17: 28,821,364 G920S probably benign Het
Cdc123 C T 2: 5,795,543 probably benign Het
Cdhr1 T C 14: 37,095,105 R100G probably benign Het
Cdkn2d A G 9: 21,290,879 V24A probably damaging Het
Cirbp T C 10: 80,170,332 probably benign Het
Col12a1 A G 9: 79,662,454 probably benign Het
Cpox T A 16: 58,674,409 C270S probably benign Het
Cspg4 A G 9: 56,896,656 D1677G probably damaging Het
Cyp4a10 T A 4: 115,524,720 probably benign Het
Dctn4 T C 18: 60,538,277 F74L possibly damaging Het
Dennd5a G A 7: 109,898,693 probably benign Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah9 C T 11: 66,145,435 S185N probably benign Het
Dqx1 T G 6: 83,058,543 probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Ep400 A C 5: 110,735,404 probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Exoc2 T C 13: 30,935,561 D119G probably benign Het
Fbn2 C T 18: 58,048,849 E1827K probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fgd6 G A 10: 94,045,041 A586T probably damaging Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm12888 A T 4: 121,324,872 W8R unknown Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm6214 A G 3: 140,839,217 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gmeb2 A G 2: 181,253,970 L469P probably benign Het
Gosr1 T C 11: 76,737,398 I177V probably benign Het
Gria1 T C 11: 57,317,708 F810L probably damaging Het
Gtf2ird2 C T 5: 134,216,498 Q533* probably null Het
Hadhb T A 5: 30,173,798 probably null Het
Hat1 A T 2: 71,410,160 Y66F possibly damaging Het
Hk1 T C 10: 62,286,536 Y488C probably benign Het
Htt C T 5: 34,825,982 T975I probably benign Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il19 T C 1: 130,939,117 H42R probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Impg2 G A 16: 56,243,630 probably null Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Itga9 T C 9: 118,807,293 F683S probably damaging Het
Itih2 A G 2: 10,130,574 S2P possibly damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Kcnab1 A G 3: 65,364,639 E315G probably benign Het
Kcnmb2 A C 3: 32,198,288 I213L probably damaging Het
Khdc1a T A 1: 21,350,972 M127K probably benign Het
Klhl28 T C 12: 64,943,472 N565S probably benign Het
Lcp1 A G 14: 75,198,075 probably null Het
Mcm4 T C 16: 15,634,469 T267A possibly damaging Het
Mlxipl A T 5: 135,132,777 T517S possibly damaging Het
Mpp3 T A 11: 102,000,690 I541L probably benign Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Myh15 G A 16: 49,155,621 A1351T possibly damaging Het
Nacc1 A T 8: 84,673,118 M490K probably benign Het
Nbeal1 C A 1: 60,270,356 Q496K possibly damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr125 T A 17: 37,835,002 M1K probably null Het
Pard3 T C 8: 127,610,611 L1236P probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Phf21a C A 2: 92,327,077 N183K possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Prl3c1 G A 13: 27,196,737 probably null Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Psg16 T G 7: 17,093,748 S210A possibly damaging Het
Psg25 T A 7: 18,521,253 K446M probably damaging Het
Ptprz1 A G 6: 23,050,389 probably benign Het
Rgs7 A T 1: 175,121,942 F160L probably damaging Het
Rpl22l1 A T 3: 28,806,808 E57D possibly damaging Het
Rpl35 A G 2: 39,004,741 L44P possibly damaging Het
Rtn4r T C 16: 18,151,257 L183P probably damaging Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc4a7 G A 14: 14,733,773 R67H probably damaging Het
Smg1 C T 7: 118,156,867 probably benign Het
Smurf2 T C 11: 106,871,548 T39A probably damaging Het
Sspo A T 6: 48,473,662 D2595V probably damaging Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Tbc1d14 G A 5: 36,522,930 R68* probably null Het
Tgm1 A G 14: 55,709,471 I360T probably damaging Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Traf1 A T 2: 34,948,190 I212N probably benign Het
Ttc17 C A 2: 94,366,547 W485L probably damaging Het
Ttn C A 2: 76,938,331 V2920F probably damaging Het
Tyr T C 7: 87,492,843 I93V probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Vmn1r212 A G 13: 22,884,115 V16A probably benign Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Xirp1 T C 9: 120,016,896 I974V probably benign Het
Zap70 A G 1: 36,779,134 T301A probably benign Het
Zfhx4 A G 3: 5,398,927 K1382E probably damaging Het
Zfp280b T A 10: 76,039,183 C299S probably damaging Het
Zfp352 C T 4: 90,225,120 S499L probably benign Het
Zfp423 G A 8: 87,781,358 A661V probably benign Het
Zfp57 T A 17: 37,009,676 F141I possibly damaging Het
Zfp946 A T 17: 22,455,465 H400L probably damaging Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Clptm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Clptm1l APN 13 73607873 splice site probably null
IGL01963:Clptm1l APN 13 73617569 splice site probably benign
IGL02169:Clptm1l APN 13 73611663 missense probably damaging 0.96
IGL02554:Clptm1l APN 13 73607760 missense probably benign 0.07
IGL02596:Clptm1l APN 13 73613666 missense probably benign 0.02
IGL02720:Clptm1l APN 13 73614602 splice site probably benign
IGL03100:Clptm1l APN 13 73612390 splice site probably benign
P0023:Clptm1l UTSW 13 73604952 missense possibly damaging 0.67
R0308:Clptm1l UTSW 13 73611667 missense possibly damaging 0.67
R0725:Clptm1l UTSW 13 73606343 missense probably benign
R1572:Clptm1l UTSW 13 73607747 missense probably benign
R1589:Clptm1l UTSW 13 73614673 critical splice donor site probably null
R2062:Clptm1l UTSW 13 73607723 nonsense probably null
R2065:Clptm1l UTSW 13 73607723 nonsense probably null
R2067:Clptm1l UTSW 13 73607723 nonsense probably null
R2068:Clptm1l UTSW 13 73607723 nonsense probably null
R3003:Clptm1l UTSW 13 73617756 missense possibly damaging 0.51
R3712:Clptm1l UTSW 13 73616038 missense probably benign 0.21
R3808:Clptm1l UTSW 13 73612454 missense probably benign 0.13
R3966:Clptm1l UTSW 13 73615972 missense probably damaging 1.00
R4615:Clptm1l UTSW 13 73607738 nonsense probably null
R4801:Clptm1l UTSW 13 73607862 missense possibly damaging 0.81
R4802:Clptm1l UTSW 13 73607862 missense possibly damaging 0.81
R4957:Clptm1l UTSW 13 73611196 missense possibly damaging 0.52
R4957:Clptm1l UTSW 13 73612428 missense probably damaging 1.00
R5864:Clptm1l UTSW 13 73606284 missense probably damaging 0.99
R6502:Clptm1l UTSW 13 73617765 critical splice donor site probably null
R6701:Clptm1l UTSW 13 73608906 missense probably benign 0.00
R6720:Clptm1l UTSW 13 73618516 missense probably damaging 1.00
R7782:Clptm1l UTSW 13 73604320 missense probably damaging 1.00
R8292:Clptm1l UTSW 13 73617735 missense probably damaging 0.96
R8329:Clptm1l UTSW 13 73612428 missense probably damaging 1.00
R9224:Clptm1l UTSW 13 73604225 start gained probably benign
R9528:Clptm1l UTSW 13 73612431 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CCAAGACTGCACCGTATTCACTT -3'
(R):5'- ACATCTTCATGTACCGATGCACA -3'

Sequencing Primer
(F):5'- TGACTCTTGGTAGTCTTTCC -3'
(R):5'- GCAGGGAGGAACCATCAAAG -3'
Posted On 2014-09-17