Mutagenetix > Incidental Mutation

Incidental Mutation 'R2064:Clptm1l'

229005

Institutional Source

Beutler Lab

Gene Symbol

Clptm1l

Ensembl Gene

ENSMUSG00000021610

Gene Name

CLPTM1-like

Synonyms

C130052I12Rik

MMRRC Submission

040069-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2064 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73604006-73620605 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 73607723 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 153 (Q153*)

Ref Sequence

ENSEMBL: ENSMUSP00000022102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022102]

AlphaFold

Q8BXA5

Predicted Effect

probably null
Transcript: ENSMUST00000022102
AA Change: Q153*

SMART Domains

Protein: ENSMUSP00000022102
Gene: ENSMUSG00000021610
AA Change: Q153*

Domain	Start	End	E-Value	Type
Pfam:CLPTM1	10	423	3.2e-134	PFAM
transmembrane domain	428	450	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221417

Meta Mutation Damage Score

0.9704

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

99% (114/115)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein whose overexpression in cisplatin-sensitive cells causes apoptosis. Polymorphisms in this gene have been reported to increase susceptibility to several cancers, including lung, pancreatic, and breast cancers. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,186,165	S402T	probably damaging	Het
4933436I01Rik	T	A	X: 67,920,702	I184L	probably benign	Het
9530002B09Rik	T	A	4: 122,689,322		probably benign	Het
Actr1b	A	G	1: 36,702,087	F138L	possibly damaging	Het
Adamts14	G	T	10: 61,205,522	P803Q	probably benign	Het
Afap1l1	A	T	18: 61,739,122		probably null	Het
Akt3	A	G	1: 177,102,985	S136P	possibly damaging	Het
Aldh16a1	C	T	7: 45,147,161		probably null	Het
Alg12	A	G	15: 88,812,115	W238R	probably damaging	Het
Amy2a1	T	C	3: 113,530,568	I108V	probably benign	Het
Arhgap23	T	A	11: 97,493,062	C1144S	probably benign	Het
Arhgef40	G	A	14: 51,996,183	V829M	probably damaging	Het
Atg7	C	A	6: 114,703,363	N344K	probably damaging	Het
Aunip	T	A	4: 134,523,307	S188T	probably benign	Het
Bmpr1b	A	T	3: 141,870,807	H88Q	probably benign	Het
Brpf3	G	A	17: 28,821,364	G920S	probably benign	Het
Cdc123	C	T	2: 5,795,543		probably benign	Het
Cdhr1	T	C	14: 37,095,105	R100G	probably benign	Het
Cdkn2d	A	G	9: 21,290,879	V24A	probably damaging	Het
Cirbp	T	C	10: 80,170,332		probably benign	Het
Col12a1	A	G	9: 79,662,454		probably benign	Het
Cpox	T	A	16: 58,674,409	C270S	probably benign	Het
Cspg4	A	G	9: 56,896,656	D1677G	probably damaging	Het
Cyp4a10	T	A	4: 115,524,720		probably benign	Het
Dctn4	T	C	18: 60,538,277	F74L	possibly damaging	Het
Dennd5a	G	A	7: 109,898,693		probably benign	Het
Dnaaf3	T	C	7: 4,523,799	I426M	possibly damaging	Het
Dnah9	C	T	11: 66,145,435	S185N	probably benign	Het
Dqx1	T	G	6: 83,058,543		probably benign	Het
Dtx2	C	T	5: 136,030,577	S493F	probably damaging	Het
Ehd1	T	C	19: 6,298,078	L362P	probably benign	Het
Endov	T	C	11: 119,499,582	F12S	probably damaging	Het
Ep400	A	C	5: 110,735,404		probably benign	Het
Epha1	G	T	6: 42,366,053	H187Q	probably benign	Het
Exoc2	T	C	13: 30,935,561	D119G	probably benign	Het
Fbn2	C	T	18: 58,048,849	E1827K	probably damaging	Het
Fbxo41	C	T	6: 85,478,471	W577*	probably null	Het
Fgd6	G	A	10: 94,045,041	A586T	probably damaging	Het
Gm12695	T	C	4: 96,769,726	T69A	probably benign	Het
Gm12888	A	T	4: 121,324,872	W8R	unknown	Het
Gm2959	A	G	14: 42,413,701		noncoding transcript	Het
Gm6214	A	G	3: 140,839,217		noncoding transcript	Het
Gm9912	T	C	3: 149,185,159	T113A	unknown	Het
Gmeb2	A	G	2: 181,253,970	L469P	probably benign	Het
Gosr1	T	C	11: 76,737,398	I177V	probably benign	Het
Gria1	T	C	11: 57,317,708	F810L	probably damaging	Het
Gtf2ird2	C	T	5: 134,216,498	Q533*	probably null	Het
Hadhb	T	A	5: 30,173,798		probably null	Het
Hat1	A	T	2: 71,410,160	Y66F	possibly damaging	Het
Hk1	T	C	10: 62,286,536	Y488C	probably benign	Het
Htt	C	T	5: 34,825,982	T975I	probably benign	Het
Ifnb1	T	A	4: 88,522,759	I6F	possibly damaging	Het
Il19	T	C	1: 130,939,117	H42R	probably benign	Het
Il2rg	A	G	X: 101,267,810	L57P	possibly damaging	Het
Impg2	G	A	16: 56,243,630		probably null	Het
Invs	T	A	4: 48,396,287	L320Q	probably damaging	Het
Itga9	T	C	9: 118,807,293	F683S	probably damaging	Het
Itih2	A	G	2: 10,130,574	S2P	possibly damaging	Het
Itpr3	G	A	17: 27,098,076	M768I	probably benign	Het
Kcnab1	A	G	3: 65,364,639	E315G	probably benign	Het
Kcnmb2	A	C	3: 32,198,288	I213L	probably damaging	Het
Khdc1a	T	A	1: 21,350,972	M127K	probably benign	Het
Klhl28	T	C	12: 64,943,472	N565S	probably benign	Het
Lcp1	A	G	14: 75,198,075		probably null	Het
Mcm4	T	C	16: 15,634,469	T267A	possibly damaging	Het
Mlxipl	A	T	5: 135,132,777	T517S	possibly damaging	Het
Mpp3	T	A	11: 102,000,690	I541L	probably benign	Het
Mpp4	G	A	1: 59,143,782	P322L	possibly damaging	Het
Myh15	G	A	16: 49,155,621	A1351T	possibly damaging	Het
Nacc1	A	T	8: 84,673,118	M490K	probably benign	Het
Nbeal1	C	A	1: 60,270,356	Q496K	possibly damaging	Het
Oas1g	T	C	5: 120,885,883	E121G	probably damaging	Het
Olfr125	T	A	17: 37,835,002	M1K	probably null	Het
Pard3	T	C	8: 127,610,611	L1236P	probably damaging	Het
Phc2	T	C	4: 128,747,136	F672S	probably damaging	Het
Phf21a	C	A	2: 92,327,077	N183K	possibly damaging	Het
Plxnb3	T	A	X: 73,771,751	Y1845*	probably null	Het
Prl3c1	G	A	13: 27,196,737		probably null	Het
Prl7a2	T	A	13: 27,660,887	Y172F	probably damaging	Het
Psg16	T	G	7: 17,093,748	S210A	possibly damaging	Het
Psg25	T	A	7: 18,521,253	K446M	probably damaging	Het
Ptprz1	A	G	6: 23,050,389		probably benign	Het
Rgs7	A	T	1: 175,121,942	F160L	probably damaging	Het
Rpl22l1	A	T	3: 28,806,808	E57D	possibly damaging	Het
Rpl35	A	G	2: 39,004,741	L44P	possibly damaging	Het
Rtn4r	T	C	16: 18,151,257	L183P	probably damaging	Het
Skint1	T	A	4: 112,025,533	V258D	probably benign	Het
Slc4a7	G	A	14: 14,733,773	R67H	probably damaging	Het
Smg1	C	T	7: 118,156,867		probably benign	Het
Smurf2	T	C	11: 106,871,548	T39A	probably damaging	Het
Sspo	A	T	6: 48,473,662	D2595V	probably damaging	Het
Tatdn2	A	G	6: 113,704,142	K379E	probably benign	Het
Tbc1d14	G	A	5: 36,522,930	R68*	probably null	Het
Tgm1	A	G	14: 55,709,471	I360T	probably damaging	Het
Thrap3	T	C	4: 126,175,396	Y654C	possibly damaging	Het
Traf1	A	T	2: 34,948,190	I212N	probably benign	Het
Ttc17	C	A	2: 94,366,547	W485L	probably damaging	Het
Ttn	C	A	2: 76,938,331	V2920F	probably damaging	Het
Tyr	T	C	7: 87,492,843	I93V	probably benign	Het
Ubap2	C	T	4: 41,199,872	A752T	probably benign	Het
Vmn1r212	A	G	13: 22,884,115	V16A	probably benign	Het
Vmn1r55	A	G	7: 5,147,049	V125A	possibly damaging	Het
Vmn2r120	T	A	17: 57,524,553	H412L	possibly damaging	Het
Xirp1	T	C	9: 120,016,896	I974V	probably benign	Het
Zap70	A	G	1: 36,779,134	T301A	probably benign	Het
Zfhx4	A	G	3: 5,398,927	K1382E	probably damaging	Het
Zfp280b	T	A	10: 76,039,183	C299S	probably damaging	Het
Zfp352	C	T	4: 90,225,120	S499L	probably benign	Het
Zfp423	G	A	8: 87,781,358	A661V	probably benign	Het
Zfp57	T	A	17: 37,009,676	F141I	possibly damaging	Het
Zfp946	A	T	17: 22,455,465	H400L	probably damaging	Het
Zgrf1	T	C	3: 127,613,350	C1589R	probably damaging	Het

Other mutations in Clptm1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01672:Clptm1l	APN	13	73607873	splice site	probably null
IGL01963:Clptm1l	APN	13	73617569	splice site	probably benign
IGL02169:Clptm1l	APN	13	73611663	missense	probably damaging	0.96
IGL02554:Clptm1l	APN	13	73607760	missense	probably benign	0.07
IGL02596:Clptm1l	APN	13	73613666	missense	probably benign	0.02
IGL02720:Clptm1l	APN	13	73614602	splice site	probably benign
IGL03100:Clptm1l	APN	13	73612390	splice site	probably benign
P0023:Clptm1l	UTSW	13	73604952	missense	possibly damaging	0.67
R0308:Clptm1l	UTSW	13	73611667	missense	possibly damaging	0.67
R0725:Clptm1l	UTSW	13	73606343	missense	probably benign
R1572:Clptm1l	UTSW	13	73607747	missense	probably benign
R1589:Clptm1l	UTSW	13	73614673	critical splice donor site	probably null
R2062:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2065:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2067:Clptm1l	UTSW	13	73607723	nonsense	probably null
R2068:Clptm1l	UTSW	13	73607723	nonsense	probably null
R3003:Clptm1l	UTSW	13	73617756	missense	possibly damaging	0.51
R3712:Clptm1l	UTSW	13	73616038	missense	probably benign	0.21
R3808:Clptm1l	UTSW	13	73612454	missense	probably benign	0.13
R3966:Clptm1l	UTSW	13	73615972	missense	probably damaging	1.00
R4615:Clptm1l	UTSW	13	73607738	nonsense	probably null
R4801:Clptm1l	UTSW	13	73607862	missense	possibly damaging	0.81
R4802:Clptm1l	UTSW	13	73607862	missense	possibly damaging	0.81
R4957:Clptm1l	UTSW	13	73611196	missense	possibly damaging	0.52
R4957:Clptm1l	UTSW	13	73612428	missense	probably damaging	1.00
R5864:Clptm1l	UTSW	13	73606284	missense	probably damaging	0.99
R6502:Clptm1l	UTSW	13	73617765	critical splice donor site	probably null
R6701:Clptm1l	UTSW	13	73608906	missense	probably benign	0.00
R6720:Clptm1l	UTSW	13	73618516	missense	probably damaging	1.00
R7782:Clptm1l	UTSW	13	73604320	missense	probably damaging	1.00
R8292:Clptm1l	UTSW	13	73617735	missense	probably damaging	0.96
R8329:Clptm1l	UTSW	13	73612428	missense	probably damaging	1.00
R9224:Clptm1l	UTSW	13	73604225	start gained	probably benign
R9528:Clptm1l	UTSW	13	73612431	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- CCAAGACTGCACCGTATTCACTT -3'
(R):5'- ACATCTTCATGTACCGATGCACA -3'

Sequencing Primer
(F):5'- TGACTCTTGGTAGTCTTTCC -3'
(R):5'- GCAGGGAGGAACCATCAAAG -3'

Posted On

2014-09-17