Incidental Mutation 'R0157:Vwa5b1'
ID22903
Institutional Source Beutler Lab
Gene Symbol Vwa5b1
Ensembl Gene ENSMUSG00000028753
Gene Namevon Willebrand factor A domain containing 5B1
Synonyms
MMRRC Submission 038437-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0157 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location138565360-138635884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 138604879 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 276 (M276L)
Ref Sequence ENSEMBL: ENSMUSP00000030533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030533] [ENSMUST00000105812]
Predicted Effect probably benign
Transcript: ENSMUST00000030533
AA Change: M276L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030533
Gene: ENSMUSG00000028753
AA Change: M276L

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 2e-28 PFAM
Pfam:VIT 15 138 1.5e-7 PFAM
VWA 351 513 6.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105812
SMART Domains Protein: ENSMUSP00000101438
Gene: ENSMUSG00000028753

DomainStartEndE-ValueType
Pfam:VIT_2 16 93 1.9e-30 PFAM
Pfam:VIT 29 103 2.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154312
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.5%
Validation Efficiency 64% (47/73)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap2 T A 11: 80,165,701 I180N probably damaging Het
Alk T A 17: 71,949,845 N673I probably benign Het
Ankrd7 T C 6: 18,866,540 S20P probably damaging Het
Arhgef26 T G 3: 62,380,971 D487E probably damaging Het
Arhgef4 A G 1: 34,806,394 D1500G probably damaging Het
Arhgef7 A G 8: 11,785,812 I39V probably damaging Het
Asap2 T A 12: 21,206,325 I208N probably damaging Het
Atad5 T C 11: 80,089,817 V16A possibly damaging Het
Atp2b1 T C 10: 98,999,947 I518T probably damaging Het
B130006D01Rik T C 11: 95,726,385 probably benign Het
BC028528 A G 3: 95,884,968 probably null Het
Bpifb6 T A 2: 153,903,966 L74Q probably benign Het
Bptf T C 11: 107,074,658 T1122A possibly damaging Het
Cacna2d4 T A 6: 119,312,424 D806E probably benign Het
Cdhr3 T C 12: 33,061,650 Q287R possibly damaging Het
Cdk12 A G 11: 98,249,776 probably benign Het
Cenpf T A 1: 189,652,359 T2575S probably benign Het
Chd7 T A 4: 8,833,759 I1171N probably damaging Het
Chd9 T C 8: 91,008,836 probably null Het
Ckmt1 A G 2: 121,363,041 T361A possibly damaging Het
Clec4d G T 6: 123,267,136 R68L probably benign Het
Csmd2 G T 4: 128,521,911 V2678F probably benign Het
Cul7 T A 17: 46,653,835 V131E possibly damaging Het
Dab2 T C 15: 6,429,827 S407P probably benign Het
Dnah17 C T 11: 118,127,171 G166D probably benign Het
F13b G A 1: 139,503,847 V52I probably benign Het
Fam208b C A 13: 3,575,550 V1467L probably benign Het
Gjd4 T C 18: 9,280,549 I176M probably benign Het
Gm13083 C T 4: 143,615,796 P158S probably damaging Het
Gm4969 T C 7: 19,107,020 H63R possibly damaging Het
Hoxc11 A G 15: 102,955,001 Y159C probably damaging Het
Hydin T C 8: 110,300,010 I120T possibly damaging Het
Il20rb A G 9: 100,473,079 Y104H probably damaging Het
Krtap21-1 A G 16: 89,403,542 C71R unknown Het
Lamc1 T C 1: 153,262,607 D167G probably benign Het
Lin7c C A 2: 109,895,169 A73E probably damaging Het
Mms22l C A 4: 24,588,224 A952E probably damaging Het
Myh3 A G 11: 67,082,909 N136S probably benign Het
Ndufb10 T C 17: 24,724,244 T31A probably benign Het
Nlrp2 T C 7: 5,308,770 Y37C possibly damaging Het
Olfr1384 T C 11: 49,513,773 I45T probably damaging Het
Olfr314 T C 11: 58,787,059 F275S probably damaging Het
Orc3 C A 4: 34,607,130 probably null Het
Pard3b A C 1: 62,211,633 M512L probably damaging Het
Pcdh10 A G 3: 45,379,701 D150G probably damaging Het
Pcolce A T 5: 137,610,479 probably null Het
Pdcl A C 2: 37,352,177 I187S probably damaging Het
Pkn1 T C 8: 83,692,820 I51M probably damaging Het
Pla2g4e T A 2: 120,170,181 T692S probably benign Het
Plcb2 C A 2: 118,718,541 V380F probably damaging Het
Pmpcb A T 5: 21,742,952 I218F probably damaging Het
Pms1 A T 1: 53,195,037 Y773* probably null Het
Polr2e C T 10: 80,036,781 G184R probably damaging Het
Polr3a T C 14: 24,479,186 I369V probably damaging Het
Prpf4b T C 13: 34,884,031 probably benign Het
Pzp G A 6: 128,523,976 Q140* probably null Het
Qrich2 T A 11: 116,441,395 E2325V probably damaging Het
R3hdm2 T G 10: 127,471,989 L373R probably damaging Het
Sema3d A T 5: 12,508,137 D212V possibly damaging Het
Sidt2 A G 9: 45,939,267 I850T probably damaging Het
Slc22a29 C T 19: 8,162,742 R433H possibly damaging Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Sox21 G A 14: 118,235,942 probably benign Het
Steap3 A G 1: 120,227,649 *527R probably null Het
Svep1 T C 4: 58,069,830 E2652G possibly damaging Het
Taar2 T A 10: 23,941,491 F310I probably damaging Het
Tecta A G 9: 42,375,011 V783A probably benign Het
Vmn1r173 T A 7: 23,702,397 I19N probably damaging Het
Yeats2 A C 16: 20,221,677 *142C probably null Het
Zfp26 G T 9: 20,437,870 T466K probably benign Het
Zfp426 T C 9: 20,471,136 N171S probably benign Het
Other mutations in Vwa5b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01952:Vwa5b1 APN 4 138581217 missense probably benign 0.08
IGL02133:Vwa5b1 APN 4 138586557 critical splice donor site probably null
IGL02379:Vwa5b1 APN 4 138612859 missense probably damaging 1.00
IGL02671:Vwa5b1 APN 4 138569126 nonsense probably null
IGL02864:Vwa5b1 APN 4 138608975 missense probably benign 0.00
IGL03076:Vwa5b1 APN 4 138600188 missense probably damaging 1.00
IGL03115:Vwa5b1 APN 4 138600149 missense possibly damaging 0.93
IGL03119:Vwa5b1 APN 4 138606541 missense probably benign 0.01
PIT4283001:Vwa5b1 UTSW 4 138600263 missense probably damaging 1.00
R0114:Vwa5b1 UTSW 4 138608858 nonsense probably null
R0528:Vwa5b1 UTSW 4 138594351 missense probably damaging 1.00
R0562:Vwa5b1 UTSW 4 138635711 splice site probably benign
R0718:Vwa5b1 UTSW 4 138608824 missense probably damaging 1.00
R1555:Vwa5b1 UTSW 4 138605477 missense probably benign 0.02
R1573:Vwa5b1 UTSW 4 138604873 missense probably damaging 1.00
R1857:Vwa5b1 UTSW 4 138569102 missense probably damaging 1.00
R1883:Vwa5b1 UTSW 4 138575389 missense probably damaging 0.96
R1906:Vwa5b1 UTSW 4 138600236 missense possibly damaging 0.93
R1913:Vwa5b1 UTSW 4 138592020 nonsense probably null
R2121:Vwa5b1 UTSW 4 138588569 missense probably benign 0.00
R2213:Vwa5b1 UTSW 4 138604812 missense probably benign 0.00
R2355:Vwa5b1 UTSW 4 138591910 critical splice donor site probably null
R2655:Vwa5b1 UTSW 4 138594303 missense probably damaging 1.00
R4134:Vwa5b1 UTSW 4 138594330 missense possibly damaging 0.69
R4135:Vwa5b1 UTSW 4 138594330 missense possibly damaging 0.69
R4635:Vwa5b1 UTSW 4 138610839 missense possibly damaging 0.82
R4773:Vwa5b1 UTSW 4 138581755 missense probably benign 0.01
R4832:Vwa5b1 UTSW 4 138605540 missense probably damaging 1.00
R4906:Vwa5b1 UTSW 4 138610747 missense probably benign 0.03
R4916:Vwa5b1 UTSW 4 138594262 missense possibly damaging 0.81
R4995:Vwa5b1 UTSW 4 138608843 missense probably damaging 1.00
R5573:Vwa5b1 UTSW 4 138608890 missense probably damaging 1.00
R5872:Vwa5b1 UTSW 4 138578651 missense possibly damaging 0.63
R6255:Vwa5b1 UTSW 4 138578672 missense probably benign 0.00
R6811:Vwa5b1 UTSW 4 138592103 missense probably benign 0.00
R6901:Vwa5b1 UTSW 4 138586569 missense probably benign
R7144:Vwa5b1 UTSW 4 138605431 critical splice donor site probably null
R7146:Vwa5b1 UTSW 4 138581612 missense probably benign 0.00
R7159:Vwa5b1 UTSW 4 138575422 missense possibly damaging 0.56
R7362:Vwa5b1 UTSW 4 138594312 missense probably damaging 1.00
R7690:Vwa5b1 UTSW 4 138590933 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGACTAAGTTCCCGTTGCCACC -3'
(R):5'- AAGATTCCTCAGGCATTTGGCTCAG -3'

Sequencing Primer
(F):5'- TCCCTTCAAGTGCTGGTCAT -3'
(R):5'- CCTGTGCAAAGATGGTGGC -3'
Posted On2013-04-16