Incidental Mutation 'R2065:Mpp4'
ID229040
Institutional Source Beutler Lab
Gene Symbol Mpp4
Ensembl Gene ENSMUSG00000079550
Gene Namemembrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)
SynonymsDLG6
MMRRC Submission 040070-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2065 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location59120935-59163389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59143782 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 322 (P322L)
Ref Sequence ENSEMBL: ENSMUSP00000070711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066374] [ENSMUST00000078874] [ENSMUST00000114275] [ENSMUST00000186477] [ENSMUST00000191200]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066374
AA Change: P322L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070711
Gene: ENSMUSG00000079550
AA Change: P322L

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 397 406 N/A INTRINSIC
GuKc 425 618 1.21e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000078874
AA Change: P322L

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077914
Gene: ENSMUSG00000079550
AA Change: P322L

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 348 362 N/A INTRINSIC
low complexity region 397 406 N/A INTRINSIC
GuKc 425 618 1.21e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114275
AA Change: P341L

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109914
Gene: ENSMUSG00000079550
AA Change: P341L

DomainStartEndE-ValueType
L27 46 101 4.02e-9 SMART
L27 105 158 2.49e-14 SMART
PDZ 180 253 3.57e-11 SMART
SH3 263 329 2.94e-5 SMART
low complexity region 367 381 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
GuKc 444 637 1.21e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186477
AA Change: P309L

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140352
Gene: ENSMUSG00000079550
AA Change: P309L

DomainStartEndE-ValueType
L27 27 82 1.3e-11 SMART
L27 86 139 8.6e-17 SMART
PDZ 161 234 1.8e-13 SMART
SH3 222 297 5.1e-4 SMART
low complexity region 353 362 N/A INTRINSIC
GuKc 381 574 5.8e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189884
Predicted Effect possibly damaging
Transcript: ENSMUST00000191200
AA Change: P322L

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140957
Gene: ENSMUSG00000079550
AA Change: P322L

DomainStartEndE-ValueType
L27 27 82 4.02e-9 SMART
L27 86 139 2.49e-14 SMART
PDZ 161 234 3.57e-11 SMART
SH3 244 310 2.94e-5 SMART
low complexity region 342 356 N/A INTRINSIC
low complexity region 391 400 N/A INTRINSIC
GuKc 419 612 1.21e-50 SMART
Meta Mutation Damage Score 0.2408 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) protein family, with an N-terminal PDZ domain, a central src homology 3 region (SH3), and a C-terminal guanylate kinase-like (GUK) domain. The protein is localized to the outer limiting membrane in the retina, and is thought to function in photoreceptor polarity and the organization of specialized intercellular junctions. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for mutations display sporadic photorecptor displacement. Correct protein localization at the presynaptic photoreceptor membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Adh6a T A 3: 138,325,237 D162E probably benign Het
Afap1l1 A T 18: 61,739,122 probably null Het
AI182371 A G 2: 35,086,429 probably null Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Aox1 T C 1: 58,059,192 probably null Het
Ap3b2 A G 7: 81,463,774 S896P unknown Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Atp11b T A 3: 35,839,074 Y859N probably damaging Het
Bag3 T A 7: 128,545,774 V371D probably damaging Het
Bhmt T C 13: 93,617,612 Y363C probably benign Het
Btbd6 T C 12: 112,978,135 Y356H probably damaging Het
C2cd2l C T 9: 44,316,335 R172Q probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cnksr2 A C X: 157,945,306 S224R possibly damaging Het
Cyp26b1 T C 6: 84,576,555 M206V probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ece1 A T 4: 137,958,082 M628L probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Erich6b T C 14: 75,658,911 I79T probably benign Het
F7 T A 8: 13,035,183 V403D probably damaging Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fbxw28 T C 9: 109,328,224 K319E probably benign Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Flg2 A G 3: 93,202,231 E522G unknown Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm7361 A T 5: 26,262,151 D256V probably damaging Het
Hpse A G 5: 100,698,931 S211P probably damaging Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Iqca T C 1: 90,130,231 S249G probably benign Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Khdc1a T A 1: 21,350,972 M127K probably benign Het
Klhl42 T A 6: 147,101,663 W312R probably damaging Het
L3mbtl4 C A 17: 68,425,692 Q56K probably benign Het
Lce1k G A 3: 92,806,857 Q7* probably null Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Mbd1 C A 18: 74,276,884 T373K probably damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nbas T A 12: 13,566,157 L2232Q probably damaging Het
Ncr1 T C 7: 4,338,207 F29L probably benign Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Olfr1295 A G 2: 111,564,712 I244T probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr487 T C 7: 108,212,340 Y63C probably damaging Het
Olfr498 T A 7: 108,465,668 C115S possibly damaging Het
Olfr705 T A 7: 106,714,166 R172W probably benign Het
Olfr709-ps1 T G 7: 106,926,955 Y168S probably damaging Het
Orc2 A G 1: 58,469,695 V431A probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pigr G A 1: 130,850,880 G767D probably benign Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Prokr1 T C 6: 87,588,713 E50G probably damaging Het
Prph A T 15: 99,056,133 D196V probably damaging Het
Rapgef5 C A 12: 117,584,119 C234* probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc22a16 A G 10: 40,585,020 I273V possibly damaging Het
Snx13 T C 12: 35,138,066 M781T possibly damaging Het
Spag17 A G 3: 100,013,208 I420V probably benign Het
Synj1 T C 16: 90,991,649 probably null Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Tcaf2 T A 6: 42,628,047 N601I probably benign Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tmem132d T C 5: 127,784,441 D872G probably benign Het
Troap T C 15: 99,082,463 L508P probably benign Het
Trpd52l3 T C 19: 30,003,962 V39A probably benign Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ubr5 T C 15: 38,040,842 D266G probably damaging Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Mpp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mpp4 APN 1 59149519 critical splice donor site probably null
IGL01346:Mpp4 APN 1 59125560 missense probably damaging 1.00
IGL01680:Mpp4 APN 1 59130067 missense probably benign 0.21
IGL02123:Mpp4 APN 1 59161466 splice site probably null
IGL02299:Mpp4 APN 1 59158579 splice site probably benign
IGL02793:Mpp4 APN 1 59136834 splice site probably null
IGL02875:Mpp4 APN 1 59136834 splice site probably null
E0370:Mpp4 UTSW 1 59139758 splice site probably benign
R0391:Mpp4 UTSW 1 59143829 splice site probably benign
R0517:Mpp4 UTSW 1 59124727 nonsense probably null
R0725:Mpp4 UTSW 1 59121422 missense probably damaging 1.00
R0968:Mpp4 UTSW 1 59130090 missense probably damaging 1.00
R1753:Mpp4 UTSW 1 59144810 missense probably null 1.00
R1956:Mpp4 UTSW 1 59158652 missense probably benign 0.01
R1968:Mpp4 UTSW 1 59144802 missense probably damaging 1.00
R2062:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2064:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2068:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2088:Mpp4 UTSW 1 59123465 missense possibly damaging 0.68
R2108:Mpp4 UTSW 1 59143782 missense possibly damaging 0.92
R2426:Mpp4 UTSW 1 59130057 missense probably damaging 0.99
R2897:Mpp4 UTSW 1 59144694 missense probably benign
R2898:Mpp4 UTSW 1 59144694 missense probably benign
R3908:Mpp4 UTSW 1 59149037 missense probably damaging 0.99
R3938:Mpp4 UTSW 1 59124683 missense possibly damaging 0.94
R4050:Mpp4 UTSW 1 59146744 splice site probably null
R4396:Mpp4 UTSW 1 59144802 missense possibly damaging 0.56
R4908:Mpp4 UTSW 1 59125589 missense probably damaging 1.00
R5169:Mpp4 UTSW 1 59130097 critical splice acceptor site probably null
R5185:Mpp4 UTSW 1 59125583 missense probably benign 0.10
R5249:Mpp4 UTSW 1 59144858 splice site probably benign
R5333:Mpp4 UTSW 1 59157441 missense probably benign 0.03
R5563:Mpp4 UTSW 1 59124629 critical splice donor site probably null
R5779:Mpp4 UTSW 1 59151666 missense probably benign 0.09
R5829:Mpp4 UTSW 1 59128942 missense probably damaging 0.99
R5934:Mpp4 UTSW 1 59121376 missense probably damaging 1.00
R6017:Mpp4 UTSW 1 59121359 missense probably damaging 1.00
R6845:Mpp4 UTSW 1 59144804 missense probably benign 0.05
R7013:Mpp4 UTSW 1 59149615 missense probably damaging 1.00
R7292:Mpp4 UTSW 1 59143810 missense possibly damaging 0.51
X0013:Mpp4 UTSW 1 59123453 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AACCCACGGACATGTTTAACTTC -3'
(R):5'- TGGTGTGCTGGAGCCAAATG -3'

Sequencing Primer
(F):5'- CCTCCATCAGATTGGCATGATTGAG -3'
(R):5'- TGCTGGAGCCAAATGACAAAGTC -3'
Posted On2014-09-17