Incidental Mutation 'R2065:Fbln7'
ID229048
Institutional Source Beutler Lab
Gene Symbol Fbln7
Ensembl Gene ENSMUSG00000027386
Gene Namefibulin 7
Synonyms1600015H20Rik
MMRRC Submission 040070-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2065 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location128862981-128897034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 128877466 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 61 (R61L)
Ref Sequence ENSEMBL: ENSMUSP00000105953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028864] [ENSMUST00000110324]
Predicted Effect probably damaging
Transcript: ENSMUST00000028864
AA Change: R61L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028864
Gene: ENSMUSG00000027386
AA Change: R61L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
CCP 81 134 7.5e-15 SMART
EGF_CA 136 172 1.46e-7 SMART
low complexity region 177 189 N/A INTRINSIC
EGF_CA 225 270 2.08e-12 SMART
EGF 274 320 1.95e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110324
AA Change: R61L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105953
Gene: ENSMUSG00000027386
AA Change: R61L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
CCP 81 134 7.5e-15 SMART
EGF_CA 136 172 1.46e-7 SMART
low complexity region 177 189 N/A INTRINSIC
EGF_CA 225 270 2.08e-12 SMART
EGF 274 320 1.95e1 SMART
Meta Mutation Damage Score 0.2906 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Adh6a T A 3: 138,325,237 D162E probably benign Het
Afap1l1 A T 18: 61,739,122 probably null Het
AI182371 A G 2: 35,086,429 probably null Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Aox1 T C 1: 58,059,192 probably null Het
Ap3b2 A G 7: 81,463,774 S896P unknown Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Atp11b T A 3: 35,839,074 Y859N probably damaging Het
Bag3 T A 7: 128,545,774 V371D probably damaging Het
Bhmt T C 13: 93,617,612 Y363C probably benign Het
Btbd6 T C 12: 112,978,135 Y356H probably damaging Het
C2cd2l C T 9: 44,316,335 R172Q probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cnksr2 A C X: 157,945,306 S224R possibly damaging Het
Cyp26b1 T C 6: 84,576,555 M206V probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ece1 A T 4: 137,958,082 M628L probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Erich6b T C 14: 75,658,911 I79T probably benign Het
F7 T A 8: 13,035,183 V403D probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fbxw28 T C 9: 109,328,224 K319E probably benign Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Flg2 A G 3: 93,202,231 E522G unknown Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm7361 A T 5: 26,262,151 D256V probably damaging Het
Hpse A G 5: 100,698,931 S211P probably damaging Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Iqca T C 1: 90,130,231 S249G probably benign Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Khdc1a T A 1: 21,350,972 M127K probably benign Het
Klhl42 T A 6: 147,101,663 W312R probably damaging Het
L3mbtl4 C A 17: 68,425,692 Q56K probably benign Het
Lce1k G A 3: 92,806,857 Q7* probably null Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Mbd1 C A 18: 74,276,884 T373K probably damaging Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nbas T A 12: 13,566,157 L2232Q probably damaging Het
Ncr1 T C 7: 4,338,207 F29L probably benign Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Olfr1295 A G 2: 111,564,712 I244T probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr487 T C 7: 108,212,340 Y63C probably damaging Het
Olfr498 T A 7: 108,465,668 C115S possibly damaging Het
Olfr705 T A 7: 106,714,166 R172W probably benign Het
Olfr709-ps1 T G 7: 106,926,955 Y168S probably damaging Het
Orc2 A G 1: 58,469,695 V431A probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pigr G A 1: 130,850,880 G767D probably benign Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Prokr1 T C 6: 87,588,713 E50G probably damaging Het
Prph A T 15: 99,056,133 D196V probably damaging Het
Rapgef5 C A 12: 117,584,119 C234* probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc22a16 A G 10: 40,585,020 I273V possibly damaging Het
Snx13 T C 12: 35,138,066 M781T possibly damaging Het
Spag17 A G 3: 100,013,208 I420V probably benign Het
Synj1 T C 16: 90,991,649 probably null Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Tcaf2 T A 6: 42,628,047 N601I probably benign Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tmem132d T C 5: 127,784,441 D872G probably benign Het
Troap T C 15: 99,082,463 L508P probably benign Het
Trpd52l3 T C 19: 30,003,962 V39A probably benign Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ubr5 T C 15: 38,040,842 D266G probably damaging Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Fbln7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Fbln7 APN 2 128893851 missense possibly damaging 0.93
IGL02161:Fbln7 APN 2 128889791 missense probably benign 0.23
IGL02383:Fbln7 APN 2 128895557 missense probably benign 0.00
IGL03273:Fbln7 APN 2 128895470 missense probably benign 0.00
R0463:Fbln7 UTSW 2 128877511 missense probably benign 0.06
R0541:Fbln7 UTSW 2 128877534 splice site probably benign
R1036:Fbln7 UTSW 2 128893895 missense possibly damaging 0.84
R1381:Fbln7 UTSW 2 128877379 missense probably damaging 1.00
R1466:Fbln7 UTSW 2 128877429 missense probably benign 0.00
R1466:Fbln7 UTSW 2 128877429 missense probably benign 0.00
R1584:Fbln7 UTSW 2 128877429 missense probably benign 0.00
R1769:Fbln7 UTSW 2 128893762 splice site probably benign
R1855:Fbln7 UTSW 2 128893835 missense possibly damaging 0.65
R2066:Fbln7 UTSW 2 128877466 missense probably damaging 0.99
R2067:Fbln7 UTSW 2 128877466 missense probably damaging 0.99
R4666:Fbln7 UTSW 2 128894910 splice site probably null
R4679:Fbln7 UTSW 2 128894886 missense probably damaging 1.00
R4694:Fbln7 UTSW 2 128880425 splice site probably null
R5933:Fbln7 UTSW 2 128877498 missense probably benign
R6211:Fbln7 UTSW 2 128895340 missense probably damaging 1.00
R6606:Fbln7 UTSW 2 128877376 missense possibly damaging 0.71
R7519:Fbln7 UTSW 2 128893865 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTCAGACTTCTGCAAGCCC -3'
(R):5'- AAGCACTCACTCACTCATACTCT -3'

Sequencing Primer
(F):5'- TTCTGCAAGCCCAGATCATGATG -3'
(R):5'- GCACTCACTCACTCATACTCTTTATC -3'
Posted On2014-09-17