Incidental Mutation 'R2065:Flg2'
ID229052
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Namefilaggrin family member 2
SynonymsEG229574
MMRRC Submission 040070-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2065 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location93197278-93221391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93202231 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 522 (E522G)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884] [ENSMUST00000194707]
Predicted Effect unknown
Transcript: ENSMUST00000098884
AA Change: E522G
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: E522G

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194707
SMART Domains Protein: ENSMUSP00000141201
Gene: ENSMUSG00000049133

DomainStartEndE-ValueType
SCOP:d1qlka_ 1 35 6e-10 SMART
low complexity region 53 64 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Adh6a T A 3: 138,325,237 D162E probably benign Het
Afap1l1 A T 18: 61,739,122 probably null Het
AI182371 A G 2: 35,086,429 probably null Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Aox1 T C 1: 58,059,192 probably null Het
Ap3b2 A G 7: 81,463,774 S896P unknown Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Atp11b T A 3: 35,839,074 Y859N probably damaging Het
Bag3 T A 7: 128,545,774 V371D probably damaging Het
Bhmt T C 13: 93,617,612 Y363C probably benign Het
Btbd6 T C 12: 112,978,135 Y356H probably damaging Het
C2cd2l C T 9: 44,316,335 R172Q probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cnksr2 A C X: 157,945,306 S224R possibly damaging Het
Cyp26b1 T C 6: 84,576,555 M206V probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ece1 A T 4: 137,958,082 M628L probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Erich6b T C 14: 75,658,911 I79T probably benign Het
F7 T A 8: 13,035,183 V403D probably damaging Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fbxw28 T C 9: 109,328,224 K319E probably benign Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm7361 A T 5: 26,262,151 D256V probably damaging Het
Hpse A G 5: 100,698,931 S211P probably damaging Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Iqca T C 1: 90,130,231 S249G probably benign Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Khdc1a T A 1: 21,350,972 M127K probably benign Het
Klhl42 T A 6: 147,101,663 W312R probably damaging Het
L3mbtl4 C A 17: 68,425,692 Q56K probably benign Het
Lce1k G A 3: 92,806,857 Q7* probably null Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Mbd1 C A 18: 74,276,884 T373K probably damaging Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nbas T A 12: 13,566,157 L2232Q probably damaging Het
Ncr1 T C 7: 4,338,207 F29L probably benign Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Olfr1295 A G 2: 111,564,712 I244T probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr487 T C 7: 108,212,340 Y63C probably damaging Het
Olfr498 T A 7: 108,465,668 C115S possibly damaging Het
Olfr705 T A 7: 106,714,166 R172W probably benign Het
Olfr709-ps1 T G 7: 106,926,955 Y168S probably damaging Het
Orc2 A G 1: 58,469,695 V431A probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pigr G A 1: 130,850,880 G767D probably benign Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Prokr1 T C 6: 87,588,713 E50G probably damaging Het
Prph A T 15: 99,056,133 D196V probably damaging Het
Rapgef5 C A 12: 117,584,119 C234* probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc22a16 A G 10: 40,585,020 I273V possibly damaging Het
Snx13 T C 12: 35,138,066 M781T possibly damaging Het
Spag17 A G 3: 100,013,208 I420V probably benign Het
Synj1 T C 16: 90,991,649 probably null Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Tcaf2 T A 6: 42,628,047 N601I probably benign Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tmem132d T C 5: 127,784,441 D872G probably benign Het
Troap T C 15: 99,082,463 L508P probably benign Het
Trpd52l3 T C 19: 30,003,962 V39A probably benign Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ubr5 T C 15: 38,040,842 D266G probably damaging Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93201335 nonsense probably null
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
R8078:Flg2 UTSW 3 93200275 missense probably damaging 1.00
R8142:Flg2 UTSW 3 93215475 nonsense probably null
R8156:Flg2 UTSW 3 93220083 missense unknown
R8172:Flg2 UTSW 3 93201161 missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93202767 missense unknown
R8262:Flg2 UTSW 3 93220210 missense unknown
R8269:Flg2 UTSW 3 93201880 missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93202762 missense unknown
R8444:Flg2 UTSW 3 93200278 missense probably damaging 0.97
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGAATCAGGTCAGTCTTGCTG -3'
(R):5'- ATGCTGCTGAGAGCCAGAAC -3'

Sequencing Primer
(F):5'- TGGCCAACATGGTACTGCATC -3'
(R):5'- CTGAGAGCCAGAACCATGATGC -3'
Posted On2014-09-17