Incidental Mutation 'R2065:Nup133'
ID229094
Institutional Source Beutler Lab
Gene Symbol Nup133
Ensembl Gene ENSMUSG00000039509
Gene Namenucleoporin 133
Synonymsmermaid, 4832420O05Rik
MMRRC Submission 040070-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2065 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123897123-123949265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 123914575 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 869 (D869Y)
Ref Sequence ENSEMBL: ENSMUSP00000048084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000044795
AA Change: D869Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: D869Y

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
PDB:1XKS|A 66 513 N/A PDB
Pfam:Nucleoporin_C 593 1052 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213089
Meta Mutation Damage Score 0.5513 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Adh6a T A 3: 138,325,237 D162E probably benign Het
Afap1l1 A T 18: 61,739,122 probably null Het
AI182371 A G 2: 35,086,429 probably null Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Aox1 T C 1: 58,059,192 probably null Het
Ap3b2 A G 7: 81,463,774 S896P unknown Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Atp11b T A 3: 35,839,074 Y859N probably damaging Het
Bag3 T A 7: 128,545,774 V371D probably damaging Het
Bhmt T C 13: 93,617,612 Y363C probably benign Het
Btbd6 T C 12: 112,978,135 Y356H probably damaging Het
C2cd2l C T 9: 44,316,335 R172Q probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cnksr2 A C X: 157,945,306 S224R possibly damaging Het
Cyp26b1 T C 6: 84,576,555 M206V probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ece1 A T 4: 137,958,082 M628L probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Erich6b T C 14: 75,658,911 I79T probably benign Het
F7 T A 8: 13,035,183 V403D probably damaging Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fbxw28 T C 9: 109,328,224 K319E probably benign Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Flg2 A G 3: 93,202,231 E522G unknown Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm7361 A T 5: 26,262,151 D256V probably damaging Het
Hpse A G 5: 100,698,931 S211P probably damaging Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Iqca T C 1: 90,130,231 S249G probably benign Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Khdc1a T A 1: 21,350,972 M127K probably benign Het
Klhl42 T A 6: 147,101,663 W312R probably damaging Het
L3mbtl4 C A 17: 68,425,692 Q56K probably benign Het
Lce1k G A 3: 92,806,857 Q7* probably null Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Mbd1 C A 18: 74,276,884 T373K probably damaging Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nbas T A 12: 13,566,157 L2232Q probably damaging Het
Ncr1 T C 7: 4,338,207 F29L probably benign Het
Olfr1295 A G 2: 111,564,712 I244T probably damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr487 T C 7: 108,212,340 Y63C probably damaging Het
Olfr498 T A 7: 108,465,668 C115S possibly damaging Het
Olfr705 T A 7: 106,714,166 R172W probably benign Het
Olfr709-ps1 T G 7: 106,926,955 Y168S probably damaging Het
Orc2 A G 1: 58,469,695 V431A probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pigr G A 1: 130,850,880 G767D probably benign Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Prokr1 T C 6: 87,588,713 E50G probably damaging Het
Prph A T 15: 99,056,133 D196V probably damaging Het
Rapgef5 C A 12: 117,584,119 C234* probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc22a16 A G 10: 40,585,020 I273V possibly damaging Het
Snx13 T C 12: 35,138,066 M781T possibly damaging Het
Spag17 A G 3: 100,013,208 I420V probably benign Het
Synj1 T C 16: 90,991,649 probably null Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Tcaf2 T A 6: 42,628,047 N601I probably benign Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tmem132d T C 5: 127,784,441 D872G probably benign Het
Troap T C 15: 99,082,463 L508P probably benign Het
Trpd52l3 T C 19: 30,003,962 V39A probably benign Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ubr5 T C 15: 38,040,842 D266G probably damaging Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Nup133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Nup133 APN 8 123939083 missense probably damaging 0.98
IGL00507:Nup133 APN 8 123918967 nonsense probably null
IGL00585:Nup133 APN 8 123909994 missense probably damaging 1.00
IGL00676:Nup133 APN 8 123906298 intron probably benign
IGL00966:Nup133 APN 8 123911906 missense probably damaging 0.98
IGL01069:Nup133 APN 8 123930982 nonsense probably null
IGL01553:Nup133 APN 8 123915324 missense possibly damaging 0.58
IGL01669:Nup133 APN 8 123939130 nonsense probably null
IGL01730:Nup133 APN 8 123938233 missense probably benign 0.00
IGL01996:Nup133 APN 8 123946595 missense probably benign 0.00
IGL02332:Nup133 APN 8 123907832 missense probably damaging 1.00
IGL02552:Nup133 APN 8 123929255 missense possibly damaging 0.75
IGL02956:Nup133 APN 8 123949083 missense probably benign 0.00
IGL03009:Nup133 APN 8 123933500 missense possibly damaging 0.46
IGL03036:Nup133 APN 8 123946594 missense probably benign 0.11
Slant UTSW 8 123916281 splice site probably null
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0139:Nup133 UTSW 8 123929343 missense probably benign 0.00
R0344:Nup133 UTSW 8 123917446 missense possibly damaging 0.82
R0730:Nup133 UTSW 8 123949008 missense probably benign 0.00
R1301:Nup133 UTSW 8 123917417 intron probably benign
R1453:Nup133 UTSW 8 123915375 missense probably benign 0.00
R1570:Nup133 UTSW 8 123949176 start codon destroyed possibly damaging 0.82
R1607:Nup133 UTSW 8 123949035 missense probably benign 0.02
R1773:Nup133 UTSW 8 123930983 nonsense probably null
R1992:Nup133 UTSW 8 123906221 missense possibly damaging 0.80
R2062:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2066:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2068:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R4397:Nup133 UTSW 8 123944301 missense probably benign 0.04
R4683:Nup133 UTSW 8 123930982 nonsense probably null
R4771:Nup133 UTSW 8 123929398 missense probably damaging 1.00
R4910:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4911:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4968:Nup133 UTSW 8 123915196 missense probably benign 0.07
R5411:Nup133 UTSW 8 123927206 missense probably benign
R5470:Nup133 UTSW 8 123930966 missense probably benign 0.00
R5664:Nup133 UTSW 8 123906281 missense probably benign 0.01
R5907:Nup133 UTSW 8 123916299 missense possibly damaging 0.90
R6003:Nup133 UTSW 8 123938292 missense probably damaging 0.98
R6059:Nup133 UTSW 8 123914596 missense probably damaging 1.00
R6219:Nup133 UTSW 8 123936873 missense possibly damaging 0.90
R6292:Nup133 UTSW 8 123917437 missense probably benign 0.01
R6672:Nup133 UTSW 8 123916281 splice site probably null
R6737:Nup133 UTSW 8 123906291 missense probably damaging 0.99
R6763:Nup133 UTSW 8 123944278 missense possibly damaging 0.95
R6870:Nup133 UTSW 8 123899507 missense probably benign 0.08
R6975:Nup133 UTSW 8 123915318 missense probably damaging 0.99
R7101:Nup133 UTSW 8 123906227 missense possibly damaging 0.89
R7114:Nup133 UTSW 8 123915373 missense probably benign 0.00
R7271:Nup133 UTSW 8 123922414 missense probably benign 0.34
R7501:Nup133 UTSW 8 123922414 missense probably benign 0.34
R8054:Nup133 UTSW 8 123949217 intron probably benign
X0023:Nup133 UTSW 8 123909988 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCAACAAGACAATGTAATGTG -3'
(R):5'- TGAGTAGTGGGAGTCTCCTC -3'

Sequencing Primer
(F):5'- ATGTGAAAATCTGTCATGTTCCCC -3'
(R):5'- TCTGGGGAGCCAGCAATG -3'
Posted On2014-09-17