Mutagenetix > Incidental Mutations

Incidental Mutation 'R0157:Nlrp2'

22912

Institutional Source

Beutler Lab

Gene Symbol

Nlrp2

Ensembl Gene

ENSMUSG00000035177

Gene Name

NLR family, pyrin domain containing 2

Synonyms

Nbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2

MMRRC Submission

038437-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0157 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5298547-5351035 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5308770 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 37 (Y37C)

Ref Sequence

ENSEMBL: ENSMUSP00000146451 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045022] [ENSMUST00000207520] [ENSMUST00000207685]

Predicted Effect

probably benign
Transcript: ENSMUST00000045022
AA Change: Y902C

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: Y902C

Domain	Start	End	E-Value	Type
PYRIN	7	90	2.88e-17	SMART
Pfam:NACHT	180	348	6.9e-30	PFAM
internal_repeat_1	676	722	1.74e-5	PROSPERO
LRR	796	823	1.26e1	SMART
LRR	825	852	1.18e1	SMART
LRR	853	880	5.81e-2	SMART
LRR	882	909	3.39e-3	SMART
LRR	910	937	5.06e-2	SMART
LRR	939	966	5.23e0	SMART
LRR	967	994	3.58e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000207520
AA Change: Y107C

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000207685
AA Change: Y37C

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207938

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 88.5%

Validation Efficiency

64% (47/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adap2	T	A	11: 80,165,701	I180N	probably damaging	Het
Alk	T	A	17: 71,949,845	N673I	probably benign	Het
Ankrd7	T	C	6: 18,866,540	S20P	probably damaging	Het
Arhgef26	T	G	3: 62,380,971	D487E	probably damaging	Het
Arhgef4	A	G	1: 34,806,394	D1500G	probably damaging	Het
Arhgef7	A	G	8: 11,785,812	I39V	probably damaging	Het
Asap2	T	A	12: 21,206,325	I208N	probably damaging	Het
Atad5	T	C	11: 80,089,817	V16A	possibly damaging	Het
Atp2b1	T	C	10: 98,999,947	I518T	probably damaging	Het
B130006D01Rik	T	C	11: 95,726,385		probably benign	Het
BC028528	A	G	3: 95,884,968		probably null	Het
Bpifb6	T	A	2: 153,903,966	L74Q	probably benign	Het
Bptf	T	C	11: 107,074,658	T1122A	possibly damaging	Het
Cacna2d4	T	A	6: 119,312,424	D806E	probably benign	Het
Cdhr3	T	C	12: 33,061,650	Q287R	possibly damaging	Het
Cdk12	A	G	11: 98,249,776		probably benign	Het
Cenpf	T	A	1: 189,652,359	T2575S	probably benign	Het
Chd7	T	A	4: 8,833,759	I1171N	probably damaging	Het
Chd9	T	C	8: 91,008,836		probably null	Het
Ckmt1	A	G	2: 121,363,041	T361A	possibly damaging	Het
Clec4d	G	T	6: 123,267,136	R68L	probably benign	Het
Csmd2	G	T	4: 128,521,911	V2678F	probably benign	Het
Cul7	T	A	17: 46,653,835	V131E	possibly damaging	Het
Dab2	T	C	15: 6,429,827	S407P	probably benign	Het
Dnah17	C	T	11: 118,127,171	G166D	probably benign	Het
F13b	G	A	1: 139,503,847	V52I	probably benign	Het
Fam208b	C	A	13: 3,575,550	V1467L	probably benign	Het
Gjd4	T	C	18: 9,280,549	I176M	probably benign	Het
Gm13083	C	T	4: 143,615,796	P158S	probably damaging	Het
Gm4969	T	C	7: 19,107,020	H63R	possibly damaging	Het
Hoxc11	A	G	15: 102,955,001	Y159C	probably damaging	Het
Hydin	T	C	8: 110,300,010	I120T	possibly damaging	Het
Il20rb	A	G	9: 100,473,079	Y104H	probably damaging	Het
Krtap21-1	A	G	16: 89,403,542	C71R	unknown	Het
Lamc1	T	C	1: 153,262,607	D167G	probably benign	Het
Lin7c	C	A	2: 109,895,169	A73E	probably damaging	Het
Mms22l	C	A	4: 24,588,224	A952E	probably damaging	Het
Myh3	A	G	11: 67,082,909	N136S	probably benign	Het
Ndufb10	T	C	17: 24,724,244	T31A	probably benign	Het
Olfr1384	T	C	11: 49,513,773	I45T	probably damaging	Het
Olfr314	T	C	11: 58,787,059	F275S	probably damaging	Het
Orc3	C	A	4: 34,607,130		probably null	Het
Pard3b	A	C	1: 62,211,633	M512L	probably damaging	Het
Pcdh10	A	G	3: 45,379,701	D150G	probably damaging	Het
Pcolce	A	T	5: 137,610,479		probably null	Het
Pdcl	A	C	2: 37,352,177	I187S	probably damaging	Het
Pkn1	T	C	8: 83,692,820	I51M	probably damaging	Het
Pla2g4e	T	A	2: 120,170,181	T692S	probably benign	Het
Plcb2	C	A	2: 118,718,541	V380F	probably damaging	Het
Pmpcb	A	T	5: 21,742,952	I218F	probably damaging	Het
Pms1	A	T	1: 53,195,037	Y773*	probably null	Het
Polr2e	C	T	10: 80,036,781	G184R	probably damaging	Het
Polr3a	T	C	14: 24,479,186	I369V	probably damaging	Het
Prpf4b	T	C	13: 34,884,031		probably benign	Het
Pzp	G	A	6: 128,523,976	Q140*	probably null	Het
Qrich2	T	A	11: 116,441,395	E2325V	probably damaging	Het
R3hdm2	T	G	10: 127,471,989	L373R	probably damaging	Het
Sema3d	A	T	5: 12,508,137	D212V	possibly damaging	Het
Sidt2	A	G	9: 45,939,267	I850T	probably damaging	Het
Slc22a29	C	T	19: 8,162,742	R433H	possibly damaging	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Sox21	G	A	14: 118,235,942		probably benign	Het
Steap3	A	G	1: 120,227,649	*527R	probably null	Het
Svep1	T	C	4: 58,069,830	E2652G	possibly damaging	Het
Taar2	T	A	10: 23,941,491	F310I	probably damaging	Het
Tecta	A	G	9: 42,375,011	V783A	probably benign	Het
Vmn1r173	T	A	7: 23,702,397	I19N	probably damaging	Het
Vwa5b1	T	A	4: 138,604,879	M276L	probably benign	Het
Yeats2	A	C	16: 20,221,677	*142C	probably null	Het
Zfp26	G	T	9: 20,437,870	T466K	probably benign	Het
Zfp426	T	C	9: 20,471,136	N171S	probably benign	Het

Other mutations in Nlrp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Nlrp2	APN	7	5337548	missense	probably benign	0.00
IGL00545:Nlrp2	APN	7	5328252	missense	possibly damaging	0.89
IGL01311:Nlrp2	APN	7	5319239	missense	possibly damaging	0.92
IGL01345:Nlrp2	APN	7	5317492	missense	probably benign	0.16
IGL01583:Nlrp2	APN	7	5337770	missense	probably damaging	1.00
IGL01659:Nlrp2	APN	7	5328035	missense	probably damaging	1.00
IGL02240:Nlrp2	APN	7	5327823	missense	probably damaging	1.00
IGL02353:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02360:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02399:Nlrp2	APN	7	5328810	missense	probably damaging	1.00
IGL02441:Nlrp2	APN	7	5335567	critical splice donor site	probably null
IGL02588:Nlrp2	APN	7	5327552	nonsense	probably null
IGL02803:Nlrp2	APN	7	5328318	missense	probably damaging	1.00
IGL02968:Nlrp2	APN	7	5301025	missense	possibly damaging	0.81
IGL03342:Nlrp2	APN	7	5317483	missense	probably damaging	1.00
BB006:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
BB016:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
R0027:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R0051:Nlrp2	UTSW	7	5322334	unclassified	probably benign
R0079:Nlrp2	UTSW	7	5327730	missense	possibly damaging	0.81
R0130:Nlrp2	UTSW	7	5322418	missense	possibly damaging	0.77
R0201:Nlrp2	UTSW	7	5328329	missense	probably benign	0.00
R0276:Nlrp2	UTSW	7	5328109	missense	probably benign	0.00
R0288:Nlrp2	UTSW	7	5328545	missense	probably benign	0.19
R0332:Nlrp2	UTSW	7	5317630	missense	probably damaging	1.00
R0724:Nlrp2	UTSW	7	5319222	missense	probably damaging	1.00
R1241:Nlrp2	UTSW	7	5328431	missense	probably damaging	1.00
R1355:Nlrp2	UTSW	7	5327491	missense	possibly damaging	0.81
R1392:Nlrp2	UTSW	7	5329015	splice site	probably benign
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1563:Nlrp2	UTSW	7	5308725	missense	probably damaging	1.00
R1866:Nlrp2	UTSW	7	5327716	nonsense	probably null
R1942:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R1959:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1960:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1961:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R2072:Nlrp2	UTSW	7	5325006	missense	probably damaging	1.00
R2161:Nlrp2	UTSW	7	5325042	missense	probably damaging	1.00
R2190:Nlrp2	UTSW	7	5319238	missense	possibly damaging	0.95
R2243:Nlrp2	UTSW	7	5335598	missense	probably benign	0.03
R2277:Nlrp2	UTSW	7	5328129	missense	probably benign
R2334:Nlrp2	UTSW	7	5337535	missense	probably benign	0.39
R3030:Nlrp2	UTSW	7	5327748	missense	probably damaging	1.00
R3404:Nlrp2	UTSW	7	5319287	missense	probably benign	0.01
R3941:Nlrp2	UTSW	7	5327552	nonsense	probably null
R4021:Nlrp2	UTSW	7	5325012	missense	probably benign	0.40
R4518:Nlrp2	UTSW	7	5325056	missense	possibly damaging	0.85
R4666:Nlrp2	UTSW	7	5319189	missense	probably benign	0.18
R4767:Nlrp2	UTSW	7	5328024	missense	probably damaging	1.00
R4827:Nlrp2	UTSW	7	5328951	missense	possibly damaging	0.60
R4873:Nlrp2	UTSW	7	5298859	missense	probably benign	0.09
R4875:Nlrp2	UTSW	7	5298859	missense	probably benign	0.09
R5020:Nlrp2	UTSW	7	5328077	missense	probably damaging	1.00
R5293:Nlrp2	UTSW	7	5327615	missense	probably damaging	1.00
R5310:Nlrp2	UTSW	7	5325008	missense	probably benign	0.00
R5336:Nlrp2	UTSW	7	5328119	missense	probably benign
R5390:Nlrp2	UTSW	7	5300909	missense	probably benign	0.00
R5864:Nlrp2	UTSW	7	5322381	missense	probably damaging	1.00
R5913:Nlrp2	UTSW	7	5324903	splice site	probably null
R6173:Nlrp2	UTSW	7	5337809	missense	probably damaging	0.96
R6274:Nlrp2	UTSW	7	5317555	missense	probably damaging	1.00
R6303:Nlrp2	UTSW	7	5337761	missense	probably damaging	1.00
R6343:Nlrp2	UTSW	7	5300926	missense	possibly damaging	0.82
R6704:Nlrp2	UTSW	7	5325041	nonsense	probably null
R6814:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R6872:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R7023:Nlrp2	UTSW	7	5328229	nonsense	probably null
R7028:Nlrp2	UTSW	7	5328572	missense	possibly damaging	0.93
R7109:Nlrp2	UTSW	7	5328617	missense	probably damaging	1.00
R7203:Nlrp2	UTSW	7	5317534	missense	probably damaging	1.00
R7322:Nlrp2	UTSW	7	5308645	missense	possibly damaging	0.94
R7339:Nlrp2	UTSW	7	5327628	missense	possibly damaging	0.95
R7573:Nlrp2	UTSW	7	5317469	critical splice donor site	probably null
R7657:Nlrp2	UTSW	7	5319168	missense	probably benign	0.01
R7929:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
R7964:Nlrp2	UTSW	7	5328528	missense	probably damaging	1.00
R8097:Nlrp2	UTSW	7	5327651	missense	probably damaging	1.00
R8276:Nlrp2	UTSW	7	5317495	missense	probably benign	0.40
X0027:Nlrp2	UTSW	7	5327642	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGACTCACTTGACTCAGGACTTCCC -3'
(R):5'- TGCCCTCATCTAGCCACATGTAGC -3'

Sequencing Primer
(F):5'- TCTGAAAGGGTCTGCTACAC -3'
(R):5'- tcactcctttccaacttccc -3'

Posted On

2013-04-16