Incidental Mutation 'R0157:Nlrp2'
ID 22912
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene Name NLR family, pyrin domain containing 2
Synonyms Pan1, Nbs1, E330007A02Rik, PYPAF2, Nalp2
MMRRC Submission 038437-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0157 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 5301546-5354034 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 5311769 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 37 (Y37C)
Ref Sequence ENSEMBL: ENSMUSP00000146451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022] [ENSMUST00000207520] [ENSMUST00000207685]
AlphaFold Q4PLS0
Predicted Effect probably benign
Transcript: ENSMUST00000045022
AA Change: Y902C

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: Y902C

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207520
AA Change: Y107C

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207685
AA Change: Y37C

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207938
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.5%
Validation Efficiency 64% (47/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap2 T A 11: 80,056,527 (GRCm39) I180N probably damaging Het
Alk T A 17: 72,256,840 (GRCm39) N673I probably benign Het
Ankrd7 T C 6: 18,866,539 (GRCm39) S20P probably damaging Het
Arhgef26 T G 3: 62,288,392 (GRCm39) D487E probably damaging Het
Arhgef4 A G 1: 34,845,475 (GRCm39) D1500G probably damaging Het
Arhgef7 A G 8: 11,835,812 (GRCm39) I39V probably damaging Het
Asap2 T A 12: 21,256,326 (GRCm39) I208N probably damaging Het
Atad5 T C 11: 79,980,643 (GRCm39) V16A possibly damaging Het
Atp2b1 T C 10: 98,835,809 (GRCm39) I518T probably damaging Het
B130006D01Rik T C 11: 95,617,211 (GRCm39) probably benign Het
BC028528 A G 3: 95,792,280 (GRCm39) probably null Het
Bpifb6 T A 2: 153,745,886 (GRCm39) L74Q probably benign Het
Bptf T C 11: 106,965,484 (GRCm39) T1122A possibly damaging Het
Cacna2d4 T A 6: 119,289,385 (GRCm39) D806E probably benign Het
Cdhr3 T C 12: 33,111,649 (GRCm39) Q287R possibly damaging Het
Cdk12 A G 11: 98,140,602 (GRCm39) probably benign Het
Cenpf T A 1: 189,384,556 (GRCm39) T2575S probably benign Het
Chd7 T A 4: 8,833,759 (GRCm39) I1171N probably damaging Het
Chd9 T C 8: 91,735,464 (GRCm39) probably null Het
Ckmt1 A G 2: 121,193,522 (GRCm39) T361A possibly damaging Het
Clec4d G T 6: 123,244,095 (GRCm39) R68L probably benign Het
Csmd2 G T 4: 128,415,704 (GRCm39) V2678F probably benign Het
Cul7 T A 17: 46,964,761 (GRCm39) V131E possibly damaging Het
Dab2 T C 15: 6,459,308 (GRCm39) S407P probably benign Het
Dnah17 C T 11: 118,017,997 (GRCm39) G166D probably benign Het
F13b G A 1: 139,431,585 (GRCm39) V52I probably benign Het
Gjd4 T C 18: 9,280,549 (GRCm39) I176M probably benign Het
Hoxc11 A G 15: 102,863,436 (GRCm39) Y159C probably damaging Het
Hydin T C 8: 111,026,642 (GRCm39) I120T possibly damaging Het
Il20rb A G 9: 100,355,132 (GRCm39) Y104H probably damaging Het
Krtap21-1 A G 16: 89,200,430 (GRCm39) C71R unknown Het
Lamc1 T C 1: 153,138,353 (GRCm39) D167G probably benign Het
Lin7c C A 2: 109,725,514 (GRCm39) A73E probably damaging Het
Meiosin T C 7: 18,840,945 (GRCm39) H63R possibly damaging Het
Mms22l C A 4: 24,588,224 (GRCm39) A952E probably damaging Het
Myh3 A G 11: 66,973,735 (GRCm39) N136S probably benign Het
Ndufb10 T C 17: 24,943,218 (GRCm39) T31A probably benign Het
Or2t44 T C 11: 58,677,885 (GRCm39) F275S probably damaging Het
Or2y14 T C 11: 49,404,600 (GRCm39) I45T probably damaging Het
Orc3 C A 4: 34,607,130 (GRCm39) probably null Het
Pard3b A C 1: 62,250,792 (GRCm39) M512L probably damaging Het
Pcdh10 A G 3: 45,334,136 (GRCm39) D150G probably damaging Het
Pcolce A T 5: 137,608,741 (GRCm39) probably null Het
Pdcl A C 2: 37,242,189 (GRCm39) I187S probably damaging Het
Pkn1 T C 8: 84,419,449 (GRCm39) I51M probably damaging Het
Pla2g4e T A 2: 120,000,662 (GRCm39) T692S probably benign Het
Plcb2 C A 2: 118,549,022 (GRCm39) V380F probably damaging Het
Pmpcb A T 5: 21,947,950 (GRCm39) I218F probably damaging Het
Pms1 A T 1: 53,234,196 (GRCm39) Y773* probably null Het
Polr2e C T 10: 79,872,615 (GRCm39) G184R probably damaging Het
Polr3a T C 14: 24,529,254 (GRCm39) I369V probably damaging Het
Pramel21 C T 4: 143,342,366 (GRCm39) P158S probably damaging Het
Prpf4b T C 13: 35,068,014 (GRCm39) probably benign Het
Pzp G A 6: 128,500,939 (GRCm39) Q140* probably null Het
Qrich2 T A 11: 116,332,221 (GRCm39) E2325V probably damaging Het
R3hdm2 T G 10: 127,307,858 (GRCm39) L373R probably damaging Het
Sema3d A T 5: 12,558,104 (GRCm39) D212V possibly damaging Het
Sidt2 A G 9: 45,850,565 (GRCm39) I850T probably damaging Het
Slc22a29 C T 19: 8,140,106 (GRCm39) R433H possibly damaging Het
Slitrk6 A T 14: 110,987,364 (GRCm39) L781H probably damaging Het
Sox21 G A 14: 118,473,354 (GRCm39) probably benign Het
Steap3 A G 1: 120,155,379 (GRCm39) *527R probably null Het
Svep1 T C 4: 58,069,830 (GRCm39) E2652G possibly damaging Het
Taar2 T A 10: 23,817,389 (GRCm39) F310I probably damaging Het
Tasor2 C A 13: 3,625,550 (GRCm39) V1467L probably benign Het
Tecta A G 9: 42,286,307 (GRCm39) V783A probably benign Het
Vmn1r173 T A 7: 23,401,822 (GRCm39) I19N probably damaging Het
Vwa5b1 T A 4: 138,332,190 (GRCm39) M276L probably benign Het
Yeats2 A C 16: 20,040,427 (GRCm39) *142C probably null Het
Zfp26 G T 9: 20,349,166 (GRCm39) T466K probably benign Het
Zfp426 T C 9: 20,382,432 (GRCm39) N171S probably benign Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5,340,547 (GRCm39) missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5,331,251 (GRCm39) missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5,322,238 (GRCm39) missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5,320,491 (GRCm39) missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5,340,769 (GRCm39) missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5,331,034 (GRCm39) missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5,330,822 (GRCm39) missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5,340,598 (GRCm39) missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5,340,598 (GRCm39) missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5,331,809 (GRCm39) missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5,338,566 (GRCm39) critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5,330,551 (GRCm39) nonsense probably null
IGL02803:Nlrp2 APN 7 5,331,317 (GRCm39) missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5,304,024 (GRCm39) missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5,320,482 (GRCm39) missense probably damaging 1.00
BB006:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
BB016:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5,325,447 (GRCm39) missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5,325,333 (GRCm39) unclassified probably benign
R0079:Nlrp2 UTSW 7 5,330,729 (GRCm39) missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5,325,417 (GRCm39) missense possibly damaging 0.77
R0201:Nlrp2 UTSW 7 5,331,328 (GRCm39) missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5,331,108 (GRCm39) missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5,331,544 (GRCm39) missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5,320,629 (GRCm39) missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5,322,221 (GRCm39) missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5,331,430 (GRCm39) missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5,330,490 (GRCm39) missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5,332,014 (GRCm39) splice site probably benign
R1470:Nlrp2 UTSW 7 5,303,950 (GRCm39) missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5,303,950 (GRCm39) missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5,311,724 (GRCm39) missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5,330,715 (GRCm39) nonsense probably null
R1942:Nlrp2 UTSW 7 5,325,447 (GRCm39) missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5,328,005 (GRCm39) missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5,328,041 (GRCm39) missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5,322,237 (GRCm39) missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5,338,597 (GRCm39) missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5,331,128 (GRCm39) missense probably benign
R2334:Nlrp2 UTSW 7 5,340,534 (GRCm39) missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5,330,747 (GRCm39) missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5,322,286 (GRCm39) missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5,330,551 (GRCm39) nonsense probably null
R4021:Nlrp2 UTSW 7 5,328,011 (GRCm39) missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5,328,055 (GRCm39) missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5,322,188 (GRCm39) missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5,331,023 (GRCm39) missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5,331,950 (GRCm39) missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5,301,858 (GRCm39) missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5,301,858 (GRCm39) missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5,331,076 (GRCm39) missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5,330,614 (GRCm39) missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5,328,007 (GRCm39) missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5,331,118 (GRCm39) missense probably benign
R5390:Nlrp2 UTSW 7 5,303,908 (GRCm39) missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5,325,380 (GRCm39) missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5,327,902 (GRCm39) splice site probably null
R6173:Nlrp2 UTSW 7 5,340,808 (GRCm39) missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5,320,554 (GRCm39) missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5,340,760 (GRCm39) missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5,303,925 (GRCm39) missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5,328,040 (GRCm39) nonsense probably null
R6814:Nlrp2 UTSW 7 5,311,709 (GRCm39) missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5,311,709 (GRCm39) missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5,331,228 (GRCm39) nonsense probably null
R7028:Nlrp2 UTSW 7 5,331,571 (GRCm39) missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5,331,616 (GRCm39) missense probably damaging 1.00
R7203:Nlrp2 UTSW 7 5,320,533 (GRCm39) missense probably damaging 1.00
R7322:Nlrp2 UTSW 7 5,311,644 (GRCm39) missense possibly damaging 0.94
R7339:Nlrp2 UTSW 7 5,330,627 (GRCm39) missense possibly damaging 0.95
R7573:Nlrp2 UTSW 7 5,320,468 (GRCm39) critical splice donor site probably null
R7657:Nlrp2 UTSW 7 5,322,167 (GRCm39) missense probably benign 0.01
R7929:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
R7964:Nlrp2 UTSW 7 5,331,527 (GRCm39) missense probably damaging 1.00
R8097:Nlrp2 UTSW 7 5,330,650 (GRCm39) missense probably damaging 1.00
R8276:Nlrp2 UTSW 7 5,320,494 (GRCm39) missense probably benign 0.40
R8785:Nlrp2 UTSW 7 5,330,548 (GRCm39) missense probably damaging 0.99
R8798:Nlrp2 UTSW 7 5,330,887 (GRCm39) missense possibly damaging 0.86
R8982:Nlrp2 UTSW 7 5,327,978 (GRCm39) missense probably damaging 1.00
R9030:Nlrp2 UTSW 7 5,325,457 (GRCm39) missense probably null 0.00
R9038:Nlrp2 UTSW 7 5,330,478 (GRCm39) missense probably benign 0.14
R9149:Nlrp2 UTSW 7 5,330,572 (GRCm39) missense probably benign 0.01
R9229:Nlrp2 UTSW 7 5,304,052 (GRCm39) missense possibly damaging 0.81
R9584:Nlrp2 UTSW 7 5,322,215 (GRCm39) missense probably damaging 1.00
X0027:Nlrp2 UTSW 7 5,330,641 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGACTCACTTGACTCAGGACTTCCC -3'
(R):5'- TGCCCTCATCTAGCCACATGTAGC -3'

Sequencing Primer
(F):5'- TCTGAAAGGGTCTGCTACAC -3'
(R):5'- tcactcctttccaacttccc -3'
Posted On 2013-04-16