Mutagenetix > Incidental Mutation

Incidental Mutation 'R2076:Rapgef1'

229134

Institutional Source

Beutler Lab

Gene Symbol

Rapgef1

Ensembl Gene

ENSMUSG00000039844

Gene Name

Rap guanine nucleotide exchange factor (GEF) 1

Synonyms

Grf2, 4932418O06Rik, C3G

MMRRC Submission

040081-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2076 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29619720-29740978 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29702508 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 466 (Q466R)

Ref Sequence

ENSEMBL: ENSMUSP00000121615 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091146] [ENSMUST00000095087] [ENSMUST00000102872] [ENSMUST00000147755]

AlphaFold

Q3UHC1

Predicted Effect

probably benign
Transcript: ENSMUST00000091146
AA Change: Q466R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000088680
Gene: ENSMUSG00000039844
AA Change: Q466R

Domain	Start	End	E-Value	Type
low complexity region	191	206	N/A	INTRINSIC
low complexity region	309	324	N/A	INTRINSIC
low complexity region	468	478	N/A	INTRINSIC
low complexity region	510	521	N/A	INTRINSIC
low complexity region	592	603	N/A	INTRINSIC
low complexity region	664	682	N/A	INTRINSIC
low complexity region	689	700	N/A	INTRINSIC
low complexity region	727	741	N/A	INTRINSIC
RasGEFN	828	970	8.04e-37	SMART
RasGEF	977	1206	5.85e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000095087
AA Change: Q504R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000092703
Gene: ENSMUSG00000039844
AA Change: Q504R

Domain	Start	End	E-Value	Type
low complexity region	229	244	N/A	INTRINSIC
low complexity region	347	362	N/A	INTRINSIC
low complexity region	506	516	N/A	INTRINSIC
low complexity region	548	559	N/A	INTRINSIC
low complexity region	630	641	N/A	INTRINSIC
low complexity region	702	720	N/A	INTRINSIC
low complexity region	727	738	N/A	INTRINSIC
RasGEFN	834	976	8.04e-37	SMART
RasGEF	983	1212	5.85e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102872
AA Change: Q504R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099936
Gene: ENSMUSG00000039844
AA Change: Q504R

Domain	Start	End	E-Value	Type
low complexity region	229	244	N/A	INTRINSIC
low complexity region	347	362	N/A	INTRINSIC
low complexity region	506	516	N/A	INTRINSIC
low complexity region	548	559	N/A	INTRINSIC
RasGEFN	696	838	8.04e-37	SMART
RasGEF	845	1074	5.85e-102	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000147488
AA Change: Q9R

SMART Domains

Protein: ENSMUSP00000117631
Gene: ENSMUSG00000039844
AA Change: Q9R

Domain	Start	End	E-Value	Type
low complexity region	12	22	N/A	INTRINSIC
low complexity region	54	65	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
RasGEFN	253	395	8.04e-37	SMART
RasGEF	402	631	5.85e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147755
AA Change: Q466R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000121615
Gene: ENSMUSG00000039844
AA Change: Q466R

Domain	Start	End	E-Value	Type
low complexity region	191	206	N/A	INTRINSIC
low complexity region	309	324	N/A	INTRINSIC
low complexity region	468	478	N/A	INTRINSIC
low complexity region	510	521	N/A	INTRINSIC
low complexity region	591	602	N/A	INTRINSIC
low complexity region	663	681	N/A	INTRINSIC

Meta Mutation Damage Score

0.0731

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human guanine nucleotide exchange factor. It transduces signals from CRK by binding the SH3 domain of CRK, and activating several members of the Ras family of GTPases. This signaling cascade that may be involved in apoptosis, integrin-mediated signal transduction, and cell transformation. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die before E7.5. Mice homozygous for a hypomorphic gene trap allele show embryonic lethality during organogenesis, altered neuroepithelium morphology, vascular maturation defects, hemorrhage, and reduced cell migration and adhesion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,219,257	D1763E	possibly damaging	Het
Abca5	A	T	11: 110,287,652	V1165D	probably benign	Het
Acot11	T	C	4: 106,770,713	H103R	probably damaging	Het
AI481877	A	G	4: 59,082,410	V406A	possibly damaging	Het
Apba1	G	T	19: 23,893,223	E140*	probably null	Het
Bicdl1	A	T	5: 115,655,928	I253N	probably damaging	Het
Ccdc159	T	C	9: 21,929,506		probably null	Het
Ccne2	A	G	4: 11,197,177	R160G	probably damaging	Het
Cct7	A	T	6: 85,468,140	I458F	probably damaging	Het
Cd3g	T	A	9: 44,974,297	D50V	probably damaging	Het
Ces2h	T	C	8: 105,019,028	L461P	probably benign	Het
Csn2	A	G	5: 87,696,174	S19P	probably damaging	Het
Cyp3a11	A	T	5: 145,879,766	V4D	probably benign	Het
Ddx3y	A	G	Y: 1,266,593		probably null	Het
Dlgap1	C	T	17: 70,786,831	Q716*	probably null	Het
Dlx6	A	G	6: 6,867,098	S234G	probably benign	Het
Dnah7a	T	C	1: 53,503,809	T2401A	probably benign	Het
Dnah7b	T	G	1: 46,242,321	Y2847*	probably null	Het
Dpysl2	A	G	14: 66,865,122	S30P	probably damaging	Het
Ezh2	A	T	6: 47,576,633	L50*	probably null	Het
Fam135b	T	A	15: 71,478,243	E349D	probably damaging	Het
Fam69c	G	T	18: 84,736,908	D170Y	probably damaging	Het
Frat2	T	C	19: 41,847,803	T37A	probably benign	Het
Gm5294	A	G	5: 138,821,267	D100G	probably benign	Het
Hivep1	G	A	13: 42,164,393		probably null	Het
Hspb11	T	C	4: 107,279,767	S121P	possibly damaging	Het
Ikbkap	T	C	4: 56,786,620	D441G	probably damaging	Het
Impdh1	G	A	6: 29,205,163	A213V	probably damaging	Het
Irf2	G	T	8: 46,845,927	W252L	probably damaging	Het
Irx4	A	G	13: 73,268,265	D260G	probably damaging	Het
Kalrn	T	A	16: 34,332,143	H338L	probably benign	Het
Kif9	T	A	9: 110,485,032		probably null	Het
Klhl24	T	C	16: 20,117,878	V412A	probably damaging	Het
Lgals8	T	A	13: 12,454,869	K70*	probably null	Het
Mkl2	T	C	16: 13,401,382	S631P	probably benign	Het
Myo1e	T	A	9: 70,383,877	N983K	probably benign	Het
Nipbl	T	C	15: 8,311,207	R2010G	probably benign	Het
Npw	A	T	17: 24,657,439	V166D	possibly damaging	Het
Osbpl5	T	C	7: 143,709,144	Y169C	probably damaging	Het
Pcdh15	T	C	10: 74,342,647	Y579H	probably damaging	Het
Pde8a	A	G	7: 81,308,945	T330A	probably benign	Het
Plxnb2	C	T	15: 89,158,026	V1592M	probably damaging	Het
Ppp2r3a	A	C	9: 101,144,371	M955R	possibly damaging	Het
Ptprk	T	A	10: 28,589,368	I1349K	probably damaging	Het
Rad52	C	T	6: 119,911,079	H9Y	probably benign	Het
Rb1cc1	T	A	1: 6,250,038	I1227N	possibly damaging	Het
Rhbdf1	T	C	11: 32,214,088	M273V	probably benign	Het
Slc30a3	G	T	5: 31,086,821	Y323*	probably null	Het
Slc5a9	T	C	4: 111,885,573	I441V	possibly damaging	Het
Spast	G	C	17: 74,352,031	G131A	probably damaging	Het
Syne1	C	G	10: 5,040,897	W8444S	probably damaging	Het
Tgm4	G	T	9: 123,051,095	A211S	probably benign	Het
Themis2	T	C	4: 132,785,802	D371G	probably damaging	Het
Tmem132e	T	A	11: 82,435,068	I206N	possibly damaging	Het
Uba3	G	T	6: 97,199,280	D88E	probably damaging	Het
Vmn1r230	T	A	17: 20,846,882	M111K	probably damaging	Het
Wdr35	C	T	12: 9,024,281	H971Y	possibly damaging	Het
Yeats2	C	A	16: 20,186,282	H356Q	possibly damaging	Het
Zfp180	A	G	7: 24,105,103	K316E	probably damaging	Het
Zfp518a	T	C	19: 40,914,327	L900P	probably damaging	Het
Zfp655	A	G	5: 145,244,600	N423D	possibly damaging	Het
Zfp932	A	G	5: 110,009,468	Q344R	probably benign	Het

Other mutations in Rapgef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Rapgef1	APN	2	29722269	missense	probably benign
IGL00917:Rapgef1	APN	2	29702523	missense	probably benign	0.00
IGL02618:Rapgef1	APN	2	29737943	missense	probably damaging	1.00
IGL02642:Rapgef1	APN	2	29700860	splice site	probably benign
IGL02974:Rapgef1	APN	2	29710216	missense	possibly damaging	0.64
R0034:Rapgef1	UTSW	2	29724768	splice site	probably benign
R0034:Rapgef1	UTSW	2	29724768	splice site	probably benign
R0241:Rapgef1	UTSW	2	29702670	missense	possibly damaging	0.53
R0241:Rapgef1	UTSW	2	29702670	missense	possibly damaging	0.53
R0279:Rapgef1	UTSW	2	29726227	missense	probably damaging	1.00
R0432:Rapgef1	UTSW	2	29679816	missense	possibly damaging	0.86
R1817:Rapgef1	UTSW	2	29686256	missense	probably damaging	1.00
R1837:Rapgef1	UTSW	2	29737426	missense	probably damaging	1.00
R1970:Rapgef1	UTSW	2	29733711	missense	probably damaging	1.00
R1980:Rapgef1	UTSW	2	29722227	missense	probably benign
R2363:Rapgef1	UTSW	2	29736596	missense	possibly damaging	0.63
R3016:Rapgef1	UTSW	2	29707393	missense	probably damaging	1.00
R3053:Rapgef1	UTSW	2	29724856	missense	probably damaging	1.00
R3777:Rapgef1	UTSW	2	29719689	missense	possibly damaging	0.67
R3980:Rapgef1	UTSW	2	29719650	missense	probably benign	0.33
R4491:Rapgef1	UTSW	2	29719656	missense	possibly damaging	0.93
R4524:Rapgef1	UTSW	2	29679246	missense	probably benign	0.00
R4732:Rapgef1	UTSW	2	29689160	missense	probably damaging	1.00
R4733:Rapgef1	UTSW	2	29689160	missense	probably damaging	1.00
R5391:Rapgef1	UTSW	2	29737965	missense	probably damaging	1.00
R5395:Rapgef1	UTSW	2	29737965	missense	probably damaging	1.00
R5611:Rapgef1	UTSW	2	29702436	missense	probably damaging	0.96
R6062:Rapgef1	UTSW	2	29700732	missense	probably damaging	0.96
R6145:Rapgef1	UTSW	2	29736666	missense	probably damaging	1.00
R6580:Rapgef1	UTSW	2	29730609	missense	possibly damaging	0.95
R6892:Rapgef1	UTSW	2	29699840	critical splice donor site	probably null
R6897:Rapgef1	UTSW	2	29702502	missense	probably damaging	1.00
R6957:Rapgef1	UTSW	2	29733698	missense	possibly damaging	0.62
R7039:Rapgef1	UTSW	2	29726214	missense	probably damaging	0.97
R7149:Rapgef1	UTSW	2	29720700	missense	probably damaging	0.98
R7253:Rapgef1	UTSW	2	29699721	missense	possibly damaging	0.72
R7315:Rapgef1	UTSW	2	29734492	missense	probably damaging	0.98
R7956:Rapgef1	UTSW	2	29699015	missense	probably benign	0.03
R8161:Rapgef1	UTSW	2	29679198	missense	probably benign	0.08
R8162:Rapgef1	UTSW	2	29735999	missense	probably damaging	0.99
R8372:Rapgef1	UTSW	2	29710231	missense	probably damaging	0.99
R8373:Rapgef1	UTSW	2	29710231	missense	probably damaging	0.99
R8485:Rapgef1	UTSW	2	29710174	missense	probably damaging	1.00
R8838:Rapgef1	UTSW	2	29737446	missense	possibly damaging	0.77
R9484:Rapgef1	UTSW	2	29735809	missense	possibly damaging	0.95
R9521:Rapgef1	UTSW	2	29734279	missense	probably benign	0.16
RF005:Rapgef1	UTSW	2	29707195	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- GGAATCTGGGCCTCCATTTC -3'
(R):5'- CACAGTGTGCTCACAGAGAG -3'

Sequencing Primer
(F):5'- GGCCACCCTTTCCAGCTG -3'
(R):5'- CAGAGAACTTACTGTGCTTGTTC -3'

Posted On

2014-09-17