Mutagenetix > Incidental Mutations

Incidental Mutation 'R2076:AI481877'

229138

Institutional Source

Beutler Lab

Gene Symbol

AI481877

Ensembl Gene

ENSMUSG00000038598

Gene Name

expressed sequence AI481877

Synonyms

LOC242489, Gm426

MMRRC Submission

040081-MU

Accession Numbers

Genbank: XM_001476641.2; Ensembl: ENSMUST00000107547

Is this an essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R2076 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59043753-59138983 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59082410 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 406 (V406A)

Ref Sequence

ENSEMBL: ENSMUSP00000103171 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107547]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107547
AA Change: V406A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103171
Gene: ENSMUSG00000038598
AA Change: V406A

Domain	Start	End	E-Value	Type
low complexity region	246	264	N/A	INTRINSIC
low complexity region	543	560	N/A	INTRINSIC
low complexity region	908	917	N/A	INTRINSIC
low complexity region	1189	1201	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122832

Meta Mutation Damage Score

0.0995

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (61/62)

Allele List at MGI

All alleles(6) : Targeted, other(1) Gene trapped(5)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,219,257	D1763E	possibly damaging	Het
Abca5	A	T	11: 110,287,652	V1165D	probably benign	Het
Acot11	T	C	4: 106,770,713	H103R	probably damaging	Het
Apba1	G	T	19: 23,893,223	E140*	probably null	Het
Bicdl1	A	T	5: 115,655,928	I253N	probably damaging	Het
Ccdc159	T	C	9: 21,929,506		probably null	Het
Ccne2	A	G	4: 11,197,177	R160G	probably damaging	Het
Cct7	A	T	6: 85,468,140	I458F	probably damaging	Het
Cd3g	T	A	9: 44,974,297	D50V	probably damaging	Het
Ces2h	T	C	8: 105,019,028	L461P	probably benign	Het
Csn2	A	G	5: 87,696,174	S19P	probably damaging	Het
Cyp3a11	A	T	5: 145,879,766	V4D	probably benign	Het
Ddx3y	A	G	Y: 1,266,593		probably null	Het
Dlgap1	C	T	17: 70,786,831	Q716*	probably null	Het
Dlx6	A	G	6: 6,867,098	S234G	probably benign	Het
Dnah7a	T	C	1: 53,503,809	T2401A	probably benign	Het
Dnah7b	T	G	1: 46,242,321	Y2847*	probably null	Het
Dpysl2	A	G	14: 66,865,122	S30P	probably damaging	Het
Ezh2	A	T	6: 47,576,633	L50*	probably null	Het
Fam135b	T	A	15: 71,478,243	E349D	probably damaging	Het
Fam69c	G	T	18: 84,736,908	D170Y	probably damaging	Het
Frat2	T	C	19: 41,847,803	T37A	probably benign	Het
Gm5294	A	G	5: 138,821,267	D100G	probably benign	Het
Hivep1	G	A	13: 42,164,393		probably null	Het
Hspb11	T	C	4: 107,279,767	S121P	possibly damaging	Het
Ikbkap	T	C	4: 56,786,620	D441G	probably damaging	Het
Impdh1	G	A	6: 29,205,163	A213V	probably damaging	Het
Irf2	G	T	8: 46,845,927	W252L	probably damaging	Het
Irx4	A	G	13: 73,268,265	D260G	probably damaging	Het
Kalrn	T	A	16: 34,332,143	H338L	probably benign	Het
Kif9	T	A	9: 110,485,032		probably null	Het
Klhl24	T	C	16: 20,117,878	V412A	probably damaging	Het
Lgals8	T	A	13: 12,454,869	K70*	probably null	Het
Mkl2	T	C	16: 13,401,382	S631P	probably benign	Het
Myo1e	T	A	9: 70,383,877	N983K	probably benign	Het
Nipbl	T	C	15: 8,311,207	R2010G	probably benign	Het
Npw	A	T	17: 24,657,439	V166D	possibly damaging	Het
Osbpl5	T	C	7: 143,709,144	Y169C	probably damaging	Het
Pcdh15	T	C	10: 74,342,647	Y579H	probably damaging	Het
Pde8a	A	G	7: 81,308,945	T330A	probably benign	Het
Plxnb2	C	T	15: 89,158,026	V1592M	probably damaging	Het
Ppp2r3a	A	C	9: 101,144,371	M955R	possibly damaging	Het
Ptprk	T	A	10: 28,589,368	I1349K	probably damaging	Het
Rad52	C	T	6: 119,911,079	H9Y	probably benign	Het
Rapgef1	A	G	2: 29,702,508	Q466R	probably benign	Het
Rb1cc1	T	A	1: 6,250,038	I1227N	possibly damaging	Het
Rhbdf1	T	C	11: 32,214,088	M273V	probably benign	Het
Slc30a3	G	T	5: 31,086,821	Y323*	probably null	Het
Slc5a9	T	C	4: 111,885,573	I441V	possibly damaging	Het
Spast	G	C	17: 74,352,031	G131A	probably damaging	Het
Syne1	C	G	10: 5,040,897	W8444S	probably damaging	Het
Tgm4	G	T	9: 123,051,095	A211S	probably benign	Het
Themis2	T	C	4: 132,785,802	D371G	probably damaging	Het
Tmem132e	T	A	11: 82,435,068	I206N	possibly damaging	Het
Uba3	G	T	6: 97,199,280	D88E	probably damaging	Het
Vmn1r230	T	A	17: 20,846,882	M111K	probably damaging	Het
Wdr35	C	T	12: 9,024,281	H971Y	possibly damaging	Het
Yeats2	C	A	16: 20,186,282	H356Q	possibly damaging	Het
Zfp180	A	G	7: 24,105,103	K316E	probably damaging	Het
Zfp518a	T	C	19: 40,914,327	L900P	probably damaging	Het
Zfp655	A	G	5: 145,244,600	N423D	possibly damaging	Het
Zfp932	A	G	5: 110,009,468	Q344R	probably benign	Het

Other mutations in AI481877

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:AI481877	APN	4	59086961	missense	probably benign
IGL00574:AI481877	APN	4	59094201	missense	possibly damaging	0.66
IGL01333:AI481877	APN	4	59047870	missense	possibly damaging	0.66
IGL02282:AI481877	APN	4	59111114	missense	unknown
IGL02418:AI481877	APN	4	59049075	splice site	probably benign
IGL02621:AI481877	APN	4	59062668	missense	probably damaging	0.97
IGL03028:AI481877	APN	4	59094274	missense	possibly damaging	0.66
IGL03112:AI481877	APN	4	59049355	missense	probably benign	0.27
IGL03137:AI481877	APN	4	59094162	missense	probably benign	0.27
IGL03220:AI481877	APN	4	59082378	nonsense	probably null
IGL03386:AI481877	APN	4	59069315	missense	possibly damaging	0.66
1mM(1):AI481877	UTSW	4	59048024	nonsense	probably null
R0071:AI481877	UTSW	4	59059643	missense	possibly damaging	0.92
R0071:AI481877	UTSW	4	59059643	missense	possibly damaging	0.92
R0194:AI481877	UTSW	4	59066534	splice site	probably benign
R0366:AI481877	UTSW	4	59099410	missense	probably benign	0.09
R0680:AI481877	UTSW	4	59043967	missense	probably benign	0.00
R1419:AI481877	UTSW	4	59064457	missense	possibly damaging	0.66
R1599:AI481877	UTSW	4	59072349	missense	possibly damaging	0.82
R1699:AI481877	UTSW	4	59113926	missense	unknown
R1799:AI481877	UTSW	4	59099383	missense	possibly damaging	0.92
R1832:AI481877	UTSW	4	59066441	missense	probably benign	0.05
R1870:AI481877	UTSW	4	59054142	splice site	probably benign
R2170:AI481877	UTSW	4	59069215	missense	possibly damaging	0.92
R2870:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2870:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2871:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2871:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2872:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2872:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2873:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R3026:AI481877	UTSW	4	59062656	missense	possibly damaging	0.83
R3079:AI481877	UTSW	4	59047848	missense	possibly damaging	0.82
R3853:AI481877	UTSW	4	59047390	missense	possibly damaging	0.66
R3914:AI481877	UTSW	4	59094201	missense	possibly damaging	0.66
R4006:AI481877	UTSW	4	59076500	missense	possibly damaging	0.53
R4364:AI481877	UTSW	4	59082294	missense	possibly damaging	0.92
R4387:AI481877	UTSW	4	59060915	missense	possibly damaging	0.66
R4454:AI481877	UTSW	4	59092383	missense	possibly damaging	0.90
R4811:AI481877	UTSW	4	59082404	missense	probably benign	0.19
R4853:AI481877	UTSW	4	59072345	missense	possibly damaging	0.66
R4899:AI481877	UTSW	4	59062640	missense	probably damaging	0.97
R5090:AI481877	UTSW	4	59111108	missense	unknown
R5169:AI481877	UTSW	4	59059618	missense	possibly damaging	0.66
R5297:AI481877	UTSW	4	59047543	missense	probably benign
R5400:AI481877	UTSW	4	59082432	missense	possibly damaging	0.83
R5419:AI481877	UTSW	4	59049017	missense	probably benign	0.04
R5668:AI481877	UTSW	4	59047399	missense	probably benign
R5770:AI481877	UTSW	4	59092466	missense	probably benign	0.00
R5783:AI481877	UTSW	4	59076239	nonsense	probably null
R5929:AI481877	UTSW	4	59092497	nonsense	probably null
R6209:AI481877	UTSW	4	59043869	makesense	probably null
R6230:AI481877	UTSW	4	59099345	missense	probably benign
R6233:AI481877	UTSW	4	59076245	missense	possibly damaging	0.92
R6351:AI481877	UTSW	4	59069317	missense	probably benign	0.00
R6785:AI481877	UTSW	4	59049066	missense	probably benign	0.01
R6884:AI481877	UTSW	4	59059652	missense	possibly damaging	0.83
R7355:AI481877	UTSW	4	59076155	missense	probably benign
R7423:AI481877	UTSW	4	59076264	missense	probably benign	0.27
R7484:AI481877	UTSW	4	59062286	missense	probably damaging	0.97
R7560:AI481877	UTSW	4	59076140	missense	possibly damaging	0.66
R7999:AI481877	UTSW	4	59094162	missense	probably benign	0.27
R8198:AI481877	UTSW	4	59065174	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- GTATTGGACATCTCATATGAGTGGTC -3'
(R):5'- TGGAATTTCACCATTTCCTACTGTG -3'

Sequencing Primer
(F):5'- GTGGTCACACAAGCTCACTTCTG -3'
(R):5'- TCACCATTTCCTACTGTGTAAAATAC -3'

Posted On

2014-09-17