Incidental Mutation 'R2076:Zfp932'
ID 229145
Institutional Source Beutler Lab
Gene Symbol Zfp932
Ensembl Gene ENSMUSG00000066613
Gene Name zinc finger protein 932
Synonyms
MMRRC Submission 040081-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R2076 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 109996521-110010411 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110009468 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 344 (Q344R)
Ref Sequence ENSEMBL: ENSMUSP00000140446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099484] [ENSMUST00000112536] [ENSMUST00000112540] [ENSMUST00000125213] [ENSMUST00000143639] [ENSMUST00000187241]
AlphaFold E9QAG8
Predicted Effect probably benign
Transcript: ENSMUST00000099484
SMART Domains Protein: ENSMUSP00000097083
Gene: ENSMUSG00000066613

DomainStartEndE-ValueType
KRAB 5 61 1.74e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112536
AA Change: Q311R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000108155
Gene: ENSMUSG00000066613
AA Change: Q311R

DomainStartEndE-ValueType
Blast:KRAB 1 31 5e-12 BLAST
ZnF_C2H2 71 93 1.1e-2 SMART
ZnF_C2H2 99 121 5.21e-4 SMART
ZnF_C2H2 127 149 3.39e-3 SMART
ZnF_C2H2 155 177 1.76e-1 SMART
ZnF_C2H2 183 205 1.3e-4 SMART
ZnF_C2H2 211 233 1.1e-2 SMART
ZnF_C2H2 239 261 2.27e-4 SMART
ZnF_C2H2 267 289 1.84e-4 SMART
ZnF_C2H2 295 317 5.21e-4 SMART
ZnF_C2H2 323 345 9.73e-4 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 1.58e-3 SMART
ZnF_C2H2 407 429 5.14e-3 SMART
ZnF_C2H2 435 457 2.61e-4 SMART
ZnF_C2H2 463 485 2.43e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112540
AA Change: Q344R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000108159
Gene: ENSMUSG00000066613
AA Change: Q344R

DomainStartEndE-ValueType
KRAB 5 61 1.74e-14 SMART
ZnF_C2H2 104 126 1.1e-2 SMART
ZnF_C2H2 132 154 5.21e-4 SMART
ZnF_C2H2 160 182 3.39e-3 SMART
ZnF_C2H2 188 210 1.76e-1 SMART
ZnF_C2H2 216 238 1.3e-4 SMART
ZnF_C2H2 244 266 1.1e-2 SMART
ZnF_C2H2 272 294 2.27e-4 SMART
ZnF_C2H2 300 322 1.84e-4 SMART
ZnF_C2H2 328 350 5.21e-4 SMART
ZnF_C2H2 356 378 9.73e-4 SMART
ZnF_C2H2 384 406 1.58e-3 SMART
ZnF_C2H2 412 434 1.58e-3 SMART
ZnF_C2H2 440 462 5.14e-3 SMART
ZnF_C2H2 468 490 2.61e-4 SMART
ZnF_C2H2 496 518 2.43e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125213
SMART Domains Protein: ENSMUSP00000119843
Gene: ENSMUSG00000066613

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-14 BLAST
ZnF_C2H2 71 93 1.1e-2 SMART
ZnF_C2H2 99 121 5.21e-4 SMART
ZnF_C2H2 127 149 3.39e-3 SMART
ZnF_C2H2 155 177 1.76e-1 SMART
Pfam:zf-C2H2_6 182 191 7.3e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143639
SMART Domains Protein: ENSMUSP00000121749
Gene: ENSMUSG00000066613

DomainStartEndE-ValueType
KRAB 4 60 1.74e-14 SMART
ZnF_C2H2 103 125 1.1e-2 SMART
ZnF_C2H2 131 153 5.21e-4 SMART
ZnF_C2H2 159 181 3.39e-3 SMART
ZnF_C2H2 187 209 1.76e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187241
AA Change: Q344R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000140446
Gene: ENSMUSG00000066613
AA Change: Q344R

DomainStartEndE-ValueType
KRAB 5 61 7.1e-17 SMART
ZnF_C2H2 104 126 4.8e-5 SMART
ZnF_C2H2 132 154 2.2e-6 SMART
ZnF_C2H2 160 182 1.5e-5 SMART
ZnF_C2H2 188 210 7.2e-4 SMART
ZnF_C2H2 216 238 5.4e-7 SMART
ZnF_C2H2 244 266 4.5e-5 SMART
ZnF_C2H2 272 294 9.2e-7 SMART
ZnF_C2H2 300 322 7.5e-7 SMART
ZnF_C2H2 328 350 2.1e-6 SMART
ZnF_C2H2 356 378 4e-6 SMART
ZnF_C2H2 384 406 6.5e-6 SMART
ZnF_C2H2 412 434 6.9e-6 SMART
ZnF_C2H2 440 462 2.1e-5 SMART
ZnF_C2H2 468 490 1.1e-6 SMART
ZnF_C2H2 496 518 1.1e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,219,257 D1763E possibly damaging Het
Abca5 A T 11: 110,287,652 V1165D probably benign Het
Acot11 T C 4: 106,770,713 H103R probably damaging Het
AI481877 A G 4: 59,082,410 V406A possibly damaging Het
Apba1 G T 19: 23,893,223 E140* probably null Het
Bicdl1 A T 5: 115,655,928 I253N probably damaging Het
Ccdc159 T C 9: 21,929,506 probably null Het
Ccne2 A G 4: 11,197,177 R160G probably damaging Het
Cct7 A T 6: 85,468,140 I458F probably damaging Het
Cd3g T A 9: 44,974,297 D50V probably damaging Het
Ces2h T C 8: 105,019,028 L461P probably benign Het
Csn2 A G 5: 87,696,174 S19P probably damaging Het
Cyp3a11 A T 5: 145,879,766 V4D probably benign Het
Ddx3y A G Y: 1,266,593 probably null Het
Dlgap1 C T 17: 70,786,831 Q716* probably null Het
Dlx6 A G 6: 6,867,098 S234G probably benign Het
Dnah7a T C 1: 53,503,809 T2401A probably benign Het
Dnah7b T G 1: 46,242,321 Y2847* probably null Het
Dpysl2 A G 14: 66,865,122 S30P probably damaging Het
Ezh2 A T 6: 47,576,633 L50* probably null Het
Fam135b T A 15: 71,478,243 E349D probably damaging Het
Fam69c G T 18: 84,736,908 D170Y probably damaging Het
Frat2 T C 19: 41,847,803 T37A probably benign Het
Gm5294 A G 5: 138,821,267 D100G probably benign Het
Hivep1 G A 13: 42,164,393 probably null Het
Hspb11 T C 4: 107,279,767 S121P possibly damaging Het
Ikbkap T C 4: 56,786,620 D441G probably damaging Het
Impdh1 G A 6: 29,205,163 A213V probably damaging Het
Irf2 G T 8: 46,845,927 W252L probably damaging Het
Irx4 A G 13: 73,268,265 D260G probably damaging Het
Kalrn T A 16: 34,332,143 H338L probably benign Het
Kif9 T A 9: 110,485,032 probably null Het
Klhl24 T C 16: 20,117,878 V412A probably damaging Het
Lgals8 T A 13: 12,454,869 K70* probably null Het
Mkl2 T C 16: 13,401,382 S631P probably benign Het
Myo1e T A 9: 70,383,877 N983K probably benign Het
Nipbl T C 15: 8,311,207 R2010G probably benign Het
Npw A T 17: 24,657,439 V166D possibly damaging Het
Osbpl5 T C 7: 143,709,144 Y169C probably damaging Het
Pcdh15 T C 10: 74,342,647 Y579H probably damaging Het
Pde8a A G 7: 81,308,945 T330A probably benign Het
Plxnb2 C T 15: 89,158,026 V1592M probably damaging Het
Ppp2r3a A C 9: 101,144,371 M955R possibly damaging Het
Ptprk T A 10: 28,589,368 I1349K probably damaging Het
Rad52 C T 6: 119,911,079 H9Y probably benign Het
Rapgef1 A G 2: 29,702,508 Q466R probably benign Het
Rb1cc1 T A 1: 6,250,038 I1227N possibly damaging Het
Rhbdf1 T C 11: 32,214,088 M273V probably benign Het
Slc30a3 G T 5: 31,086,821 Y323* probably null Het
Slc5a9 T C 4: 111,885,573 I441V possibly damaging Het
Spast G C 17: 74,352,031 G131A probably damaging Het
Syne1 C G 10: 5,040,897 W8444S probably damaging Het
Tgm4 G T 9: 123,051,095 A211S probably benign Het
Themis2 T C 4: 132,785,802 D371G probably damaging Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Uba3 G T 6: 97,199,280 D88E probably damaging Het
Vmn1r230 T A 17: 20,846,882 M111K probably damaging Het
Wdr35 C T 12: 9,024,281 H971Y possibly damaging Het
Yeats2 C A 16: 20,186,282 H356Q possibly damaging Het
Zfp180 A G 7: 24,105,103 K316E probably damaging Het
Zfp518a T C 19: 40,914,327 L900P probably damaging Het
Zfp655 A G 5: 145,244,600 N423D possibly damaging Het
Other mutations in Zfp932
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0153:Zfp932 UTSW 5 110006968 missense probably benign 0.27
R0268:Zfp932 UTSW 5 110009063 missense probably benign 0.24
R1673:Zfp932 UTSW 5 110008988 missense probably damaging 1.00
R1797:Zfp932 UTSW 5 109996623 start gained probably benign
R1893:Zfp932 UTSW 5 110009203 missense possibly damaging 0.71
R1942:Zfp932 UTSW 5 110006987 missense probably damaging 1.00
R2073:Zfp932 UTSW 5 110009818 missense possibly damaging 0.60
R2329:Zfp932 UTSW 5 110009540 missense probably benign 0.01
R3944:Zfp932 UTSW 5 110009954 missense probably benign 0.37
R4551:Zfp932 UTSW 5 110009639 missense probably benign 0.03
R4679:Zfp932 UTSW 5 110009894 missense probably damaging 1.00
R4692:Zfp932 UTSW 5 110009186 missense probably damaging 1.00
R5116:Zfp932 UTSW 5 110009376 missense probably benign 0.05
R5260:Zfp932 UTSW 5 110009635 nonsense probably null
R5536:Zfp932 UTSW 5 110009847 nonsense probably null
R6351:Zfp932 UTSW 5 110009343 nonsense probably null
R6786:Zfp932 UTSW 5 110009740 missense probably damaging 0.98
R6843:Zfp932 UTSW 5 110008715 missense probably benign 0.02
R7437:Zfp932 UTSW 5 110010014 missense probably benign 0.10
R7496:Zfp932 UTSW 5 110008828 missense probably damaging 0.97
R7704:Zfp932 UTSW 5 110009764 missense probably benign 0.09
R8224:Zfp932 UTSW 5 109996614 start gained probably benign
R8317:Zfp932 UTSW 5 110009056 nonsense probably null
R8765:Zfp932 UTSW 5 110006961 missense probably benign 0.01
R8967:Zfp932 UTSW 5 110009017 missense probably benign 0.00
R9083:Zfp932 UTSW 5 110009234 missense probably damaging 1.00
R9142:Zfp932 UTSW 5 110009654 missense probably damaging 1.00
R9511:Zfp932 UTSW 5 110007311 missense possibly damaging 0.46
R9533:Zfp932 UTSW 5 110009921 missense probably damaging 1.00
R9640:Zfp932 UTSW 5 110009198 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTTTGTATGTAATGCCAGTCTC -3'
(R):5'- GATATGCAAGGGCTTTACCACAT -3'

Sequencing Primer
(F):5'- GTATGTAATGCCAGTCTCCGTACAC -3'
(R):5'- GTGTCGTGCAAAGGCTTTACCAC -3'
Posted On 2014-09-17