Incidental Mutation 'R2076:Irf2'
ID229159
Institutional Source Beutler Lab
Gene Symbol Irf2
Ensembl Gene ENSMUSG00000031627
Gene Nameinterferon regulatory factor 2
SynonymsIrf-2, 9830146E22Rik
MMRRC Submission 040081-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R2076 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location46739732-46847458 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46845927 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 252 (W252L)
Ref Sequence ENSEMBL: ENSMUSP00000034041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034041] [ENSMUST00000210218] [ENSMUST00000210284]
PDB Structure
INTERFERON REGULATORY FACTOR-2 DNA BINDING DOMAIN, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
INTERFERON REGULATORY FACTOR-2 DNA BINDING DOMAIN, NMR, 20 STRUCTURES [SOLUTION NMR]
CRYSTAL STRUCTURE OF AN IRF-2/DNA COMPLEX. [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034041
AA Change: W252L

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034041
Gene: ENSMUSG00000031627
AA Change: W252L

DomainStartEndE-ValueType
IRF 1 114 4.09e-61 SMART
low complexity region 115 132 N/A INTRINSIC
Blast:IRF 247 301 3e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000210218
Predicted Effect probably benign
Transcript: ENSMUST00000210284
Meta Mutation Damage Score 0.1265 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRF2 encodes interferon regulatory factor 2, a member of the interferon regulatory transcription factor (IRF) family. IRF2 competitively inhibits the IRF1-mediated transcriptional activation of interferons alpha and beta, and presumably other genes that employ IRF1 for transcription activation. However, IRF2 also functions as a transcriptional activator of histone H4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in B lymphopoiesis and hematopoiesis, often die prematurely, show increased mortality following lymphocytic choriomeningitis virus infection, and develop an inflammatory skin disease involving CD8+ Tcells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,219,257 D1763E possibly damaging Het
Abca5 A T 11: 110,287,652 V1165D probably benign Het
Acot11 T C 4: 106,770,713 H103R probably damaging Het
AI481877 A G 4: 59,082,410 V406A possibly damaging Het
Apba1 G T 19: 23,893,223 E140* probably null Het
Bicdl1 A T 5: 115,655,928 I253N probably damaging Het
Ccdc159 T C 9: 21,929,506 probably null Het
Ccne2 A G 4: 11,197,177 R160G probably damaging Het
Cct7 A T 6: 85,468,140 I458F probably damaging Het
Cd3g T A 9: 44,974,297 D50V probably damaging Het
Ces2h T C 8: 105,019,028 L461P probably benign Het
Csn2 A G 5: 87,696,174 S19P probably damaging Het
Cyp3a11 A T 5: 145,879,766 V4D probably benign Het
Ddx3y A G Y: 1,266,593 probably null Het
Dlgap1 C T 17: 70,786,831 Q716* probably null Het
Dlx6 A G 6: 6,867,098 S234G probably benign Het
Dnah7a T C 1: 53,503,809 T2401A probably benign Het
Dnah7b T G 1: 46,242,321 Y2847* probably null Het
Dpysl2 A G 14: 66,865,122 S30P probably damaging Het
Ezh2 A T 6: 47,576,633 L50* probably null Het
Fam135b T A 15: 71,478,243 E349D probably damaging Het
Fam69c G T 18: 84,736,908 D170Y probably damaging Het
Frat2 T C 19: 41,847,803 T37A probably benign Het
Gm5294 A G 5: 138,821,267 D100G probably benign Het
Hivep1 G A 13: 42,164,393 probably null Het
Hspb11 T C 4: 107,279,767 S121P possibly damaging Het
Ikbkap T C 4: 56,786,620 D441G probably damaging Het
Impdh1 G A 6: 29,205,163 A213V probably damaging Het
Irx4 A G 13: 73,268,265 D260G probably damaging Het
Kalrn T A 16: 34,332,143 H338L probably benign Het
Kif9 T A 9: 110,485,032 probably null Het
Klhl24 T C 16: 20,117,878 V412A probably damaging Het
Lgals8 T A 13: 12,454,869 K70* probably null Het
Mkl2 T C 16: 13,401,382 S631P probably benign Het
Myo1e T A 9: 70,383,877 N983K probably benign Het
Nipbl T C 15: 8,311,207 R2010G probably benign Het
Npw A T 17: 24,657,439 V166D possibly damaging Het
Osbpl5 T C 7: 143,709,144 Y169C probably damaging Het
Pcdh15 T C 10: 74,342,647 Y579H probably damaging Het
Pde8a A G 7: 81,308,945 T330A probably benign Het
Plxnb2 C T 15: 89,158,026 V1592M probably damaging Het
Ppp2r3a A C 9: 101,144,371 M955R possibly damaging Het
Ptprk T A 10: 28,589,368 I1349K probably damaging Het
Rad52 C T 6: 119,911,079 H9Y probably benign Het
Rapgef1 A G 2: 29,702,508 Q466R probably benign Het
Rb1cc1 T A 1: 6,250,038 I1227N possibly damaging Het
Rhbdf1 T C 11: 32,214,088 M273V probably benign Het
Slc30a3 G T 5: 31,086,821 Y323* probably null Het
Slc5a9 T C 4: 111,885,573 I441V possibly damaging Het
Spast G C 17: 74,352,031 G131A probably damaging Het
Syne1 C G 10: 5,040,897 W8444S probably damaging Het
Tgm4 G T 9: 123,051,095 A211S probably benign Het
Themis2 T C 4: 132,785,802 D371G probably damaging Het
Tmem132e T A 11: 82,435,068 I206N possibly damaging Het
Uba3 G T 6: 97,199,280 D88E probably damaging Het
Vmn1r230 T A 17: 20,846,882 M111K probably damaging Het
Wdr35 C T 12: 9,024,281 H971Y possibly damaging Het
Yeats2 C A 16: 20,186,282 H356Q possibly damaging Het
Zfp180 A G 7: 24,105,103 K316E probably damaging Het
Zfp518a T C 19: 40,914,327 L900P probably damaging Het
Zfp655 A G 5: 145,244,600 N423D possibly damaging Het
Zfp932 A G 5: 110,009,468 Q344R probably benign Het
Other mutations in Irf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Irf2 APN 8 46807225 missense probably damaging 1.00
IGL02251:Irf2 APN 8 46807753 critical splice donor site probably null
IGL02403:Irf2 APN 8 46846172 missense probably damaging 1.00
IGL03208:Irf2 APN 8 46807305 missense probably damaging 1.00
Gentle UTSW 8 46807281 missense probably damaging 1.00
softie UTSW 8 46807279 missense probably damaging 1.00
R0053:Irf2 UTSW 8 46818851 missense probably benign 0.44
R0053:Irf2 UTSW 8 46818851 missense probably benign 0.44
R0411:Irf2 UTSW 8 46846061 missense probably benign
R1523:Irf2 UTSW 8 46837840 critical splice donor site probably null
R1888:Irf2 UTSW 8 46807353 nonsense probably null
R1888:Irf2 UTSW 8 46807353 nonsense probably null
R2059:Irf2 UTSW 8 46807345 missense probably damaging 1.00
R2259:Irf2 UTSW 8 46837833 missense probably benign 0.00
R4691:Irf2 UTSW 8 46846187 missense probably damaging 1.00
R5722:Irf2 UTSW 8 46818796 missense possibly damaging 0.95
R7163:Irf2 UTSW 8 46837677 missense possibly damaging 0.83
R7216:Irf2 UTSW 8 46793556 missense probably benign
R7337:Irf2 UTSW 8 46807281 missense probably damaging 1.00
R7792:Irf2 UTSW 8 46807279 missense probably damaging 1.00
X0053:Irf2 UTSW 8 46807267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTGCCATCATGTTCCG -3'
(R):5'- TTCTTGATGACACTGGCCCG -3'

Sequencing Primer
(F):5'- CGTGTCTTTGTAGAACAGTCTTGACC -3'
(R):5'- TCTGGCCGACTGCTGCTG -3'
Posted On2014-09-17