Mutagenetix > Incidental Mutations

Incidental Mutation 'R2076:Ces2h'

229160

Institutional Source

Beutler Lab

Gene Symbol

Ces2h

Ensembl Gene

ENSMUSG00000091813

Gene Name

carboxylesterase 2H

Synonyms

Gm5744

MMRRC Submission

040081-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R2076 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105000853-105021178 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 105019028 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 461 (L461P)

Ref Sequence

ENSEMBL: ENSMUSP00000126773 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172032]

AlphaFold

F6Z9B9

Predicted Effect

probably benign
Transcript: ENSMUST00000172032
AA Change: L461P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126773
Gene: ENSMUSG00000091813
AA Change: L461P

Domain	Start	End	E-Value	Type
Pfam:COesterase	9	537	2.5e-167	PFAM
Pfam:Abhydrolase_3	142	275	4.1e-11	PFAM
Pfam:Peptidase_S9	161	326	3.3e-8	PFAM
coiled coil region	538	558	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212347

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. The protein encoded by this gene is the major intestinal enzyme and functions in intestine drug clearance. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,219,257	D1763E	possibly damaging	Het
Abca5	A	T	11: 110,287,652	V1165D	probably benign	Het
Acot11	T	C	4: 106,770,713	H103R	probably damaging	Het
AI481877	A	G	4: 59,082,410	V406A	possibly damaging	Het
Apba1	G	T	19: 23,893,223	E140*	probably null	Het
Bicdl1	A	T	5: 115,655,928	I253N	probably damaging	Het
Ccdc159	T	C	9: 21,929,506		probably null	Het
Ccne2	A	G	4: 11,197,177	R160G	probably damaging	Het
Cct7	A	T	6: 85,468,140	I458F	probably damaging	Het
Cd3g	T	A	9: 44,974,297	D50V	probably damaging	Het
Csn2	A	G	5: 87,696,174	S19P	probably damaging	Het
Cyp3a11	A	T	5: 145,879,766	V4D	probably benign	Het
Ddx3y	A	G	Y: 1,266,593		probably null	Het
Dlgap1	C	T	17: 70,786,831	Q716*	probably null	Het
Dlx6	A	G	6: 6,867,098	S234G	probably benign	Het
Dnah7a	T	C	1: 53,503,809	T2401A	probably benign	Het
Dnah7b	T	G	1: 46,242,321	Y2847*	probably null	Het
Dpysl2	A	G	14: 66,865,122	S30P	probably damaging	Het
Ezh2	A	T	6: 47,576,633	L50*	probably null	Het
Fam135b	T	A	15: 71,478,243	E349D	probably damaging	Het
Fam69c	G	T	18: 84,736,908	D170Y	probably damaging	Het
Frat2	T	C	19: 41,847,803	T37A	probably benign	Het
Gm5294	A	G	5: 138,821,267	D100G	probably benign	Het
Hivep1	G	A	13: 42,164,393		probably null	Het
Hspb11	T	C	4: 107,279,767	S121P	possibly damaging	Het
Ikbkap	T	C	4: 56,786,620	D441G	probably damaging	Het
Impdh1	G	A	6: 29,205,163	A213V	probably damaging	Het
Irf2	G	T	8: 46,845,927	W252L	probably damaging	Het
Irx4	A	G	13: 73,268,265	D260G	probably damaging	Het
Kalrn	T	A	16: 34,332,143	H338L	probably benign	Het
Kif9	T	A	9: 110,485,032		probably null	Het
Klhl24	T	C	16: 20,117,878	V412A	probably damaging	Het
Lgals8	T	A	13: 12,454,869	K70*	probably null	Het
Mkl2	T	C	16: 13,401,382	S631P	probably benign	Het
Myo1e	T	A	9: 70,383,877	N983K	probably benign	Het
Nipbl	T	C	15: 8,311,207	R2010G	probably benign	Het
Npw	A	T	17: 24,657,439	V166D	possibly damaging	Het
Osbpl5	T	C	7: 143,709,144	Y169C	probably damaging	Het
Pcdh15	T	C	10: 74,342,647	Y579H	probably damaging	Het
Pde8a	A	G	7: 81,308,945	T330A	probably benign	Het
Plxnb2	C	T	15: 89,158,026	V1592M	probably damaging	Het
Ppp2r3a	A	C	9: 101,144,371	M955R	possibly damaging	Het
Ptprk	T	A	10: 28,589,368	I1349K	probably damaging	Het
Rad52	C	T	6: 119,911,079	H9Y	probably benign	Het
Rapgef1	A	G	2: 29,702,508	Q466R	probably benign	Het
Rb1cc1	T	A	1: 6,250,038	I1227N	possibly damaging	Het
Rhbdf1	T	C	11: 32,214,088	M273V	probably benign	Het
Slc30a3	G	T	5: 31,086,821	Y323*	probably null	Het
Slc5a9	T	C	4: 111,885,573	I441V	possibly damaging	Het
Spast	G	C	17: 74,352,031	G131A	probably damaging	Het
Syne1	C	G	10: 5,040,897	W8444S	probably damaging	Het
Tgm4	G	T	9: 123,051,095	A211S	probably benign	Het
Themis2	T	C	4: 132,785,802	D371G	probably damaging	Het
Tmem132e	T	A	11: 82,435,068	I206N	possibly damaging	Het
Uba3	G	T	6: 97,199,280	D88E	probably damaging	Het
Vmn1r230	T	A	17: 20,846,882	M111K	probably damaging	Het
Wdr35	C	T	12: 9,024,281	H971Y	possibly damaging	Het
Yeats2	C	A	16: 20,186,282	H356Q	possibly damaging	Het
Zfp180	A	G	7: 24,105,103	K316E	probably damaging	Het
Zfp518a	T	C	19: 40,914,327	L900P	probably damaging	Het
Zfp655	A	G	5: 145,244,600	N423D	possibly damaging	Het
Zfp932	A	G	5: 110,009,468	Q344R	probably benign	Het

Other mutations in Ces2h

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01530:Ces2h	APN	8	105014484	missense	probably benign	0.01
IGL02268:Ces2h	APN	8	105019940	missense	probably benign	0.00
IGL03133:Ces2h	APN	8	105016779	missense	probably damaging	1.00
R0138:Ces2h	UTSW	8	105018061	missense	probably benign	0.01
R0294:Ces2h	UTSW	8	105016604	missense	probably benign	0.01
R0482:Ces2h	UTSW	8	105020271	missense	possibly damaging	0.48
R0899:Ces2h	UTSW	8	105014550	missense	probably damaging	1.00
R1232:Ces2h	UTSW	8	105014655	missense	probably benign	0.38
R1535:Ces2h	UTSW	8	105014486	missense	probably benign	0.06
R1738:Ces2h	UTSW	8	105019065	critical splice donor site	probably null
R1748:Ces2h	UTSW	8	105017841	missense	probably benign	0.00
R1759:Ces2h	UTSW	8	105016611	missense	probably damaging	1.00
R1778:Ces2h	UTSW	8	105014607	missense	possibly damaging	0.93
R1833:Ces2h	UTSW	8	105020373	missense	possibly damaging	0.93
R1999:Ces2h	UTSW	8	105020345	missense	probably benign	0.03
R2018:Ces2h	UTSW	8	105018398	missense	probably damaging	1.00
R2261:Ces2h	UTSW	8	105016559	missense	probably damaging	0.99
R2262:Ces2h	UTSW	8	105016559	missense	probably damaging	0.99
R2356:Ces2h	UTSW	8	105015938	missense	probably damaging	0.98
R4453:Ces2h	UTSW	8	105014656	critical splice donor site	probably null
R4656:Ces2h	UTSW	8	105014639	missense	possibly damaging	0.80
R4732:Ces2h	UTSW	8	105014604	missense	probably damaging	0.97
R4733:Ces2h	UTSW	8	105014604	missense	probably damaging	0.97
R5219:Ces2h	UTSW	8	105016646	missense	probably damaging	1.00
R5400:Ces2h	UTSW	8	105018425	missense	probably benign	0.01
R5696:Ces2h	UTSW	8	105018979	missense	possibly damaging	0.69
R5894:Ces2h	UTSW	8	105019026	missense	probably benign	0.14
R6688:Ces2h	UTSW	8	105017840	missense	probably benign
R6711:Ces2h	UTSW	8	105018083	missense	probably benign	0.22
R6868:Ces2h	UTSW	8	105018423	missense	probably benign	0.02
R7233:Ces2h	UTSW	8	105017456	missense	probably damaging	0.99
R7516:Ces2h	UTSW	8	105016826	missense	probably damaging	1.00
R7710:Ces2h	UTSW	8	105000865	nonsense	probably null
R7735:Ces2h	UTSW	8	105014495	missense	probably benign	0.01
R7803:Ces2h	UTSW	8	105018400	missense	probably benign	0.00
R8922:Ces2h	UTSW	8	105018124	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TCTTGTCATCACAGTTGAGGAAGG -3'
(R):5'- TGATTCCATGGCCCACACAG -3'

Sequencing Primer
(F):5'- TTGAGGAAGGACATCCCCTG -3'
(R):5'- GGAAGGGACCTGAGTTTCTAATCTC -3'

Posted On

2014-09-17